pycom03g19930

Catalyzes the phosphorylation of ribose at O-5 in a reaction requiring ATP and magnesium. The resulting D-ribose-5- phosphate can then be used either for sythesis of nucleotides, histidine, and tryptophan, or as a component of the pentose phosphate pathway

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Reverse (-)
20546043 .. 20546237
195 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g19930.1

Sequence Viewer

Length: 195 bp
ATGTTGCAGTCTGATGGGCAGAACTCCATCATCATTGTTGGTGGGGCCACCATTAAGTGCTGGTCTGAGAGGATTTCTGACGAGGATTTGAAGCTTGTGAACAATGCTGGGATTGTTTTGCTTCAGAGGGAGATTCCGGAATCGGTCAACGTTCAGGTTGCAAAGGTCCGGGCTTTCAATTTTTTAAATTTGTAA

Protein Analysis

65

Amino Acids

7.07

Weight (kDa)

5.1

Isoelectric Point (pI)

31.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019813)

Species Orthologous Gene IDs
pyrus_communis pycom03g19930
rosa_chinensis RchiOBHm_Chr5g0028931
rosa_laevigata RLG00000033128
rosa_multiflora Rmu_sc0040883.1_g000001 Rmu_sc0040884.1_g000001
rosa_samantha Rh5CG222900 Rh5DG205900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 136
AclI AACGTT 1 cut(s) 150
AcsI RAATTY 1 cut(s) 187
AcuI CTGAAG 1 cut(s) 107
AgsI TTSAA 2 cut(s) 91, 178
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Aor13HI TCCGGA 1 cut(s) 136
AoxI GGCC 1 cut(s) 45
ApoI RAATTY 1 cut(s) 187
AspS9I GGNCC 2 cut(s) 45, 166
AsuC2I CCSGG 1 cut(s) 170
AvaII GGWCC 1 cut(s) 166
BccI CCATC 2 cut(s) 8, 35
BcnI CCSGG 1 cut(s) 170
Bme1390I CCNGG 1 cut(s) 170
Bme18I GGWCC 1 cut(s) 166
BmgT120I GGNCC 2 cut(s) 45, 166
BmiI GGNNCC 1 cut(s) 46
BmrFI CCNGG 1 cut(s) 170
BpuMI CCSGG 1 cut(s) 170
BsaWI WCCGGW 1 cut(s) 136
BseAI TCCGGA 1 cut(s) 136
BseMII CTCAG 1 cut(s) 57
BseYI CCCAGC 1 cut(s) 107
BshFI GGCC 1 cut(s) 47
BsiSI CCGG 2 cut(s) 137, 169
BsnI GGCC 1 cut(s) 47
Bsp13I TCCGGA 1 cut(s) 136
BspANI GGCC 1 cut(s) 47
BspCNI CTCAG 1 cut(s) 58
BspEI TCCGGA 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 46
BstDEI CTNAG 1 cut(s) 66
BstSCI CCNGG 1 cut(s) 168
BsuRI GGCC 1 cut(s) 47
Cfr13I GGNCC 2 cut(s) 45, 166
CviJI RGCY 3 cut(s) 47, 94, 173
CviKI_1 RGCY 3 cut(s) 47, 94, 173
DdeI CTNAG 1 cut(s) 66
DraI TTTAAA 1 cut(s) 186
Eco47I GGWCC 1 cut(s) 166
Eco57I CTGAAG 1 cut(s) 107
GsaI CCCAGC 1 cut(s) 111
HaeIII GGCC 1 cut(s) 47
HapII CCGG 2 cut(s) 137, 169
HincII GTYRAC 1 cut(s) 148
HindII GTYRAC 1 cut(s) 148
HindIII AAGCTT 1 cut(s) 92
HinfI GANTC 2 cut(s) 133, 140
HpaII CCGG 2 cut(s) 137, 169
Hpy166II GTNNAC 2 cut(s) 100, 148
Hpy188I TCNGA 4 cut(s) 13, 67, 79, 126
Hpy188III TCNNGA 1 cut(s) 137
Hpy8I GTNNAC 2 cut(s) 100, 148
HpyCH4IV ACGT 1 cut(s) 150
HpyCH4V TGCA 2 cut(s) 7, 161
HpyF3I CTNAG 1 cut(s) 66
HpySE526I ACGT 1 cut(s) 150
Kpn2I TCCGGA 1 cut(s) 136
LpnPI CCDG 5 cut(s) 46, 93, 140, 150, 182
MaeII ACGT 1 cut(s) 150
MluCI AATT 2 cut(s) 178, 187
MnlI CCTC 3 cut(s) 63, 76, 120
MroI TCCGGA 1 cut(s) 136
MseI TTAA 2 cut(s) 54, 185
MspI CCGG 2 cut(s) 137, 169
MspR9I CCNGG 1 cut(s) 170
NciI CCSGG 1 cut(s) 170
NlaIV GGNNCC 1 cut(s) 46
PfeI GAWTC 2 cut(s) 133, 140
Psp1406I AACGTT 1 cut(s) 150
PspFI CCCAGC 1 cut(s) 107
PspN4I GGNNCC 1 cut(s) 46
PspPI GGNCC 2 cut(s) 45, 166
SaqAI TTAA 2 cut(s) 54, 185
Sau96I GGNCC 2 cut(s) 45, 166
ScrFI CCNGG 1 cut(s) 170
SetI ASST 4 cut(s) 96, 153, 159, 168
SgeI CNNG 8 cut(s) 73, 94, 107, 120, 149, 167, 181, 182
SinI GGWCC 1 cut(s) 166
Sse9I AATT 2 cut(s) 178, 187
StyD4I CCNGG 1 cut(s) 168
TaiI ACGT 1 cut(s) 153
TaqII GACCGA 1 cut(s) 133
TasI AATT 2 cut(s) 178, 187
TfiI GAWTC 2 cut(s) 133, 140
Tru1I TTAA 2 cut(s) 54, 185
Tru9I TTAA 2 cut(s) 54, 185
VpaK11BI GGWCC 1 cut(s) 166
XapI RAATTY 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.