pycom04g09580

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
12291608 .. 12291847
240 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g09580.1

Sequence Viewer

Length: 240 bp
ATGAAGAGTCGACTCCTTCTGGATGTTGTAATCCGCCAAGGTCCTGCCGTCCTCCAATTGTTTCCCAGCAAAGATAAGCCTCTGCTGATCAGGAGGAATACCCTCCTTGTCTTGAATCTTCGCCTTCACATTGTCAATCGTATCCGAGCTTTCAACCTCCAGAGTGATAGTCTTCCCGGTAAGAGTCTTCACAAAAATCTGCATACCACCCCTCAATCGAAGGACCAAATGCAAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.06

Weight (kDa)

11.64

Isoelectric Point (pI)

66.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020995)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G65349
prunus_persica Prupe.6G278900_v2.0.a1
pyrus_communis pycom04g09580 pycom11g19920
rosa_roxburghii Rroxscaffold_5G00382740

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 10
AciI CCGC 1 cut(s) 34
AgsI TTSAA 2 cut(s) 115, 154
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
AspS9I GGNCC 2 cut(s) 41, 223
AsuC2I CCSGG 1 cut(s) 177
AvaII GGWCC 2 cut(s) 41, 223
BbsI GAAGAC 2 cut(s) 164, 179
BceAI ACGGC 1 cut(s) 32
BciVI GTATCC 1 cut(s) 152
BclI TGATCA 1 cut(s) 87
BcnI CCSGG 1 cut(s) 177
BfuI GTATCC 1 cut(s) 152
Bme1390I CCNGG 1 cut(s) 177
Bme18I GGWCC 2 cut(s) 41, 223
BmgT120I GGNCC 2 cut(s) 41, 223
BmrFI CCNGG 1 cut(s) 177
BpiI GAAGAC 2 cut(s) 164, 179
BpmI CTGGAG 1 cut(s) 143
BpuMI CCSGG 1 cut(s) 177
BsaJI CCNNGG 1 cut(s) 37
BseDI CCNNGG 1 cut(s) 37
BseGI GGATG 1 cut(s) 28
BseYI CCCAGC 1 cut(s) 65
BsiSI CCGG 1 cut(s) 177
Bsp143I GATC 1 cut(s) 87
BspACI CCGC 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 37
BssMI GATC 1 cut(s) 87
BssT1I CCWWGG 1 cut(s) 37
BstF5I GGATG 1 cut(s) 28
BstKTI GATC 1 cut(s) 90
BstMBI GATC 1 cut(s) 87
BstSCI CCNGG 1 cut(s) 175
BstV2I GAAGAC 2 cut(s) 164, 179
BsuI GTATCC 1 cut(s) 152
BtsCI GGATG 1 cut(s) 28
Cfr13I GGNCC 2 cut(s) 41, 223
CviJI RGCY 2 cut(s) 79, 149
CviKI_1 RGCY 2 cut(s) 79, 149
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
EciI GGCGGA 1 cut(s) 23
Eco130I CCWWGG 1 cut(s) 37
Eco47I GGWCC 2 cut(s) 41, 223
EcoO109I RGGNCCY 1 cut(s) 41
EcoT14I CCWWGG 1 cut(s) 37
ErhI CCWWGG 1 cut(s) 37
FaiI YATR 1 cut(s) 204
FbaI TGATCA 1 cut(s) 87
FblI GTMKAC 1 cut(s) 10
FokI GGATG 1 cut(s) 35
GsaI CCCAGC 1 cut(s) 69
GsuI CTGGAG 1 cut(s) 143
HapII CCGG 1 cut(s) 177
HincII GTYRAC 1 cut(s) 11
HindII GTYRAC 1 cut(s) 11
HinfI GANTC 4 cut(s) 7, 12, 115, 184
HpaII CCGG 1 cut(s) 177
Hpy166II GTNNAC 1 cut(s) 11
Hpy188I TCNGA 1 cut(s) 146
Hpy188III TCNNGA 4 cut(s) 20, 91, 112, 160
Hpy8I GTNNAC 1 cut(s) 11
HpyAV CCTTC 3 cut(s) 26, 134, 214
HpyCH4V TGCA 2 cut(s) 202, 232
Ksp22I TGATCA 1 cut(s) 87
Kzo9I GATC 1 cut(s) 87
LpnPI CCDG 6 cut(s) 5, 57, 76, 79, 173, 190
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MboII GAAGA 4 cut(s) 16, 110, 164, 179
MfeI CAATTG 1 cut(s) 56
MluCI AATT 1 cut(s) 56
MlyI GAGTC 3 cut(s) 6, 16, 193
MnlI CCTC 6 cut(s) 62, 87, 90, 113, 167, 222
MspI CCGG 1 cut(s) 177
MspR9I CCNGG 1 cut(s) 177
MunI CAATTG 1 cut(s) 56
NciI CCSGG 1 cut(s) 177
NdeII GATC 1 cut(s) 87
PfeI GAWTC 1 cut(s) 115
PleI GAGTC 3 cut(s) 6, 15, 192
PpsI GAGTC 3 cut(s) 6, 15, 192
PpuMI RGGWCCY 1 cut(s) 41
Psp5II RGGWCCY 1 cut(s) 41
PspFI CCCAGC 1 cut(s) 65
PspPI GGNCC 2 cut(s) 41, 223
PspPPI RGGWCCY 1 cut(s) 41
SalI GTCGAC 1 cut(s) 9
Sau3AI GATC 1 cut(s) 87
Sau96I GGNCC 2 cut(s) 41, 223
SchI GAGTC 3 cut(s) 6, 16, 193
ScrFI CCNGG 1 cut(s) 177
SetI ASST 3 cut(s) 43, 151, 159
SinI GGWCC 2 cut(s) 41, 223
Sse9I AATT 1 cut(s) 56
SsiI CCGC 1 cut(s) 34
StyD4I CCNGG 1 cut(s) 175
StyI CCWWGG 1 cut(s) 37
TaqI TCGA 2 cut(s) 10, 218
TasI AATT 1 cut(s) 56
TfiI GAWTC 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 2 cut(s) 41, 223
XmiI GTMKAC 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.