pycom04g11010

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0021261
Physical Location & Seq
Reverse (-)
13828604 .. 13828951
348 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g11010.1

Sequence Viewer

Length: 348 bp
ATGGTAGGTTTATGGGGGACTGGTGGAATTGGTAAATCAACAATTGCCAAAGCTGTTTATAATTTAATTTCCCACAAATTCGAAGGTAGTTGCTTTCTCAACAAGGTTAGAGAAAGTTCAATGACAGATAAAGGATTGGCCAAATTACAAAAGACACTTCTTGATGAGATTCTAGGGGGAGACAAGTTGAAGGTGGCCAATGTTGATAAAGGAATCACTTTAATAAAGGAAAGATTAAGCGGTAAAAGGATTCTCTTAGTTCTTGATGTTGTGAACGACATGAGACAGTTACGCTACTTAGTTGGGGGGATCGATCAAGAGGCAAGATGGTTGGTTTGGCATTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
NB-ARC TIR

Protein Analysis

116

Amino Acids

12.87

Weight (kDa)

9.63

Isoelectric Point (pI)

29.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NB-ARC PF00931 1 - 101 2.1e-09 NB-ARC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021261)

Species Orthologous Gene IDs
pyrus_communis pycom04g11010 pycom15g33760
rosa_chinensis RchiOBHm_Chr6g0275961
rosa_multiflora Rmu_sc0007384.1_g000004
rosa_samantha Rh3CG276200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 60
AciI CCGC 1 cut(s) 240
AclWI GGATC 1 cut(s) 317
AcoI YGGCCR 2 cut(s) 138, 195
AcsI RAATTY 1 cut(s) 77
AgsI TTSAA 2 cut(s) 120, 190
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
Alw26I GTCTC 2 cut(s) 174, 277
AlwI GGATC 1 cut(s) 317
AoxI GGCC 2 cut(s) 138, 195
ApoI RAATTY 1 cut(s) 77
AsuII TTCGAA 1 cut(s) 81
BalI TGGCCA 2 cut(s) 140, 197
BccI CCATC 1 cut(s) 321
BcoDI GTCTC 2 cut(s) 174, 277
BfaI CTAG 1 cut(s) 173
Bpu14I TTCGAA 1 cut(s) 81
Bsa29I ATCGAT 1 cut(s) 312
Bse1I ACTGG 1 cut(s) 25
BseCI ATCGAT 1 cut(s) 312
BseNI ACTGG 1 cut(s) 25
BshFI GGCC 2 cut(s) 140, 197
BshVI ATCGAT 1 cut(s) 312
BslFI GGGAC 1 cut(s) 31
BsmAI GTCTC 2 cut(s) 174, 277
BsmFI GGGAC 1 cut(s) 31
BsnI GGCC 2 cut(s) 140, 197
Bsp119I TTCGAA 1 cut(s) 81
Bsp143I GATC 2 cut(s) 309, 313
BspACI CCGC 1 cut(s) 240
BspANI GGCC 2 cut(s) 140, 197
BspDI ATCGAT 1 cut(s) 312
BspPI GGATC 1 cut(s) 317
BspT104I TTCGAA 1 cut(s) 81
BsrI ACTGG 1 cut(s) 25
BssMI GATC 2 cut(s) 309, 313
Bst4CI ACNGT 1 cut(s) 288
BstBI TTCGAA 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 256, 298
BstKTI GATC 2 cut(s) 312, 316
BstMAI GTCTC 2 cut(s) 174, 277
BstMBI GATC 2 cut(s) 309, 313
Bsu15I ATCGAT 1 cut(s) 312
BsuRI GGCC 2 cut(s) 140, 197
BsuTUI ATCGAT 1 cut(s) 312
ClaI ATCGAT 1 cut(s) 312
CviAII CATG 1 cut(s) 280
CviJI RGCY 3 cut(s) 53, 140, 197
CviKI_1 RGCY 3 cut(s) 53, 140, 197
DdeI CTNAG 2 cut(s) 256, 298
DpnI GATC 2 cut(s) 311, 315
DpnII GATC 2 cut(s) 309, 313
EaeI YGGCCR 2 cut(s) 138, 195
FaeI CATG 1 cut(s) 283
FaiI YATR 3 cut(s) 13, 60, 281
FaqI GGGAC 1 cut(s) 31
FatI CATG 1 cut(s) 279
FspBI CTAG 1 cut(s) 173
HaeIII GGCC 2 cut(s) 140, 197
Hin1II CATG 1 cut(s) 283
HinfI GANTC 3 cut(s) 169, 213, 250
Hpy166II GTNNAC 1 cut(s) 274
Hpy188III TCNNGA 3 cut(s) 161, 263, 317
Hpy8I GTNNAC 1 cut(s) 274
HpyAV CCTTC 2 cut(s) 77, 184
HpyCH4III ACNGT 1 cut(s) 288
HpyF3I CTNAG 2 cut(s) 256, 298
Hsp92II CATG 1 cut(s) 283
Kzo9I GATC 2 cut(s) 309, 313
LpnPI CCDG 1 cut(s) 6
MaeI CTAG 1 cut(s) 173
MaeIII GTNAC 1 cut(s) 288
MalI GATC 2 cut(s) 311, 315
MboI GATC 2 cut(s) 309, 313
MfeI CAATTG 1 cut(s) 42
MlsI TGGCCA 2 cut(s) 140, 197
MluCI AATT 6 cut(s) 27, 42, 61, 66, 77, 143
MluNI TGGCCA 2 cut(s) 140, 197
MnlI CCTC 1 cut(s) 313
Mox20I TGGCCA 2 cut(s) 140, 197
MscI TGGCCA 2 cut(s) 140, 197
MseI TTAA 3 cut(s) 65, 221, 236
Msp20I TGGCCA 2 cut(s) 140, 197
MunI CAATTG 1 cut(s) 42
NdeII GATC 2 cut(s) 309, 313
NlaIII CATG 1 cut(s) 283
NspV TTCGAA 1 cut(s) 81
PfeI GAWTC 3 cut(s) 169, 213, 250
PsiI TTATAA 1 cut(s) 60
SaqAI TTAA 3 cut(s) 65, 221, 236
Sau3AI GATC 2 cut(s) 309, 313
SetI ASST 5 cut(s) 10, 55, 88, 108, 195
SfuI TTCGAA 1 cut(s) 81
SgeI CNNG 9 cut(s) 33, 115, 173, 185, 196, 275, 292, 329, 336
Sse9I AATT 6 cut(s) 27, 42, 61, 66, 77, 143
SsiI CCGC 1 cut(s) 240
SspMI CTAG 1 cut(s) 173
TaaI ACNGT 1 cut(s) 288
TaqI TCGA 2 cut(s) 81, 312
TasI AATT 6 cut(s) 27, 42, 61, 66, 77, 143
TfiI GAWTC 3 cut(s) 169, 213, 250
Tru1I TTAA 3 cut(s) 65, 221, 236
Tru9I TTAA 3 cut(s) 65, 221, 236
XapI RAATTY 1 cut(s) 77
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.