Rh3CG276200

microtubule motor activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
27501954 .. 27518021
16068 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG276200.1

Sequence Viewer

Length: 198 bp
ATGGGTTTGCTTTTAGCTCCTGCGGAGAAGGATGTTCGATTTATAGGAATATGGGGTATGGGTGGAGTGGGTAAGACTACCCTTGCTAGGCTAGTGTACGAGAAAATTTCCCATCATTTTGAGGTGGCTAAGTTTCTTGTTGATGTCAGGAAGCGTTCACTAGTCGATCTTCAAAAACAGGACCCATTTGTTTTGTGA

Protein Analysis

65

Amino Acids

7.34

Weight (kDa)

9.6

Isoelectric Point (pI)

28.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NB-ARC PF00931 9 - 59 2.3e-09 NB-ARC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021261)

Species Orthologous Gene IDs
pyrus_communis pycom04g11010 pycom15g33760
rosa_chinensis RchiOBHm_Chr6g0275961
rosa_multiflora Rmu_sc0007384.1_g000004
rosa_samantha Rh3CG276200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 23
AcsI RAATTY 1 cut(s) 105
AfaI GTAC 1 cut(s) 98
AfiI CCNNNNNNNGG 1 cut(s) 87
AgsI TTSAA 1 cut(s) 173
AhlI ACTAGT 1 cut(s) 160
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
ApoI RAATTY 1 cut(s) 105
AspS9I GGNCC 1 cut(s) 181
AvaII GGWCC 1 cut(s) 181
BccI CCATC 1 cut(s) 120
BcuI ACTAGT 1 cut(s) 160
BfaI CTAG 3 cut(s) 87, 92, 161
Bme18I GGWCC 1 cut(s) 181
BmgT120I GGNCC 1 cut(s) 181
BmiI GGNNCC 1 cut(s) 183
Bsc4I CCNNNNNNNGG 1 cut(s) 87
BseGI GGATG 1 cut(s) 37
BseLI CCNNNNNNNGG 1 cut(s) 87
BslI CCNNNNNNNGG 1 cut(s) 87
Bsp143I GATC 1 cut(s) 166
BspACI CCGC 1 cut(s) 23
BspLI GGNNCC 1 cut(s) 183
BssMI GATC 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 129
BstF5I GGATG 1 cut(s) 37
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BtsCI GGATG 1 cut(s) 37
Cfr13I GGNCC 1 cut(s) 181
Csp6I GTAC 1 cut(s) 97
CviJI RGCY 3 cut(s) 17, 91, 128
CviKI_1 RGCY 3 cut(s) 17, 91, 128
CviQI GTAC 1 cut(s) 97
DdeI CTNAG 1 cut(s) 129
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
Eco47I GGWCC 1 cut(s) 181
EcoO109I RGGNCCY 1 cut(s) 181
FaiI YATR 3 cut(s) 44, 52, 59
FokI GGATG 1 cut(s) 44
FspBI CTAG 3 cut(s) 87, 92, 161
Hpy166II GTNNAC 2 cut(s) 97, 158
Hpy188III TCNNGA 1 cut(s) 148
Hpy8I GTNNAC 2 cut(s) 97, 158
HpyAV CCTTC 1 cut(s) 22
HpyF3I CTNAG 1 cut(s) 129
Kzo9I GATC 1 cut(s) 166
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 3 cut(s) 33, 133, 164
MaeI CTAG 3 cut(s) 87, 92, 161
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 1 cut(s) 161
MluCI AATT 1 cut(s) 105
MnlI CCTC 1 cut(s) 115
NdeII GATC 1 cut(s) 166
NlaIV GGNNCC 1 cut(s) 183
PpuMI RGGWCCY 1 cut(s) 181
Psp5II RGGWCCY 1 cut(s) 181
PspN4I GGNNCC 1 cut(s) 183
PspPI GGNCC 1 cut(s) 181
PspPPI RGGWCCY 1 cut(s) 181
RsaI GTAC 1 cut(s) 98
RsaNI GTAC 1 cut(s) 97
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 181
SetI ASST 2 cut(s) 19, 126
SgeI CNNG 9 cut(s) 32, 95, 99, 104, 112, 149, 160, 173, 191
SinI GGWCC 1 cut(s) 181
SpeI ACTAGT 1 cut(s) 160
Sse9I AATT 1 cut(s) 105
SsiI CCGC 1 cut(s) 23
SspMI CTAG 3 cut(s) 87, 92, 161
TaqI TCGA 2 cut(s) 37, 165
TasI AATT 1 cut(s) 105
VpaK11BI GGWCC 1 cut(s) 181
XapI RAATTY 1 cut(s) 105
XspI CTAG 3 cut(s) 87, 92, 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.