Rmu_sc0007384.1_g000004

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007384.1
Physical Location & Seq
Reverse (-)
10322 .. 14855
4534 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007384.1_g000004.1.cds

Sequence Viewer

Length: 1008 bp
atgaatccaagtttatccagaatattgatgaagagatctcaattcaaagtatcaaatcggacatacatgaaagttgctaagaatcctgtaggactggaatctcgtgtccgggatatgcatgagcttctatgtgttgaggaaaatgatgttcgcatggtgggaatatggggaattggaggaattggtaagacaactgttgccaaagctgtttatgggtcaattgctcatcgatttgaaggtagctgttttttggaaaatgtgagagaaaggtcattagtgccacatgaaggcttggttcaactgcaagaaactcttctttccaagattttagggggtgtaggagtgaagctgagcaatgttgatgatcctgcttatgatatagagaaaagactttggaataagagggacggagatggtgaatcggaatctggctggggagaacgagttggtgaagaggaagaagcagtgagttggagtaggaggaaggcgaggaagaagaagcggaggtcgcagactcagagatcgccgacgacagtggccggaaataatattccaaagtggttcaatttttgtaagcatccaactgatcatgagtattgcgagtttgttattaaacttcctccaaatttcagtggaaagaattcgagattggctttatcggctgtgtttgaaagcatggatggaacactaacctatgattataatgattatggaaaacacgcgtttcatgtccgagtctacattaatggtgatgaaatattttgggttcaccagcatctacttattcgtccggggtcaaatcatgcgtggctgcagtatgtttcgttatctgatatgaggcattgggggggacggtggaatgaagagcaacttttgagcaagtgtgaagtgagatttttgtcttctaaaccactttccttgaaagcttgtggtctccaactagtatacccccgaaacgagtatggcaacattgatcaaaacttagcagatcttcaatttttctcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

335

Amino Acids

38.41

Weight (kDa)

9.0

Isoelectric Point (pI)

50.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021261)

Species Orthologous Gene IDs
pyrus_communis pycom04g11010 pycom15g33760
rosa_chinensis RchiOBHm_Chr6g0275961
rosa_multiflora Rmu_sc0007384.1_g000004
rosa_samantha Rh3CG276200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 702
AccI GTMKAC 2 cut(s) 738, 945
AccII CGCG 1 cut(s) 722
AciI CCGC 1 cut(s) 502
AclWI GGATC 1 cut(s) 359
AcoI YGGCCR 1 cut(s) 537
AcsI RAATTY 2 cut(s) 625, 640
AfiI CCNNNNNNNGG 1 cut(s) 287
AflIII ACRYGT 1 cut(s) 720
AgsI TTSAA 7 cut(s) 46, 236, 299, 565, 671, 922, 995
AhlI ACTAGT 1 cut(s) 940
AjuI GAANNNNNNNTTGG 2 cut(s) 632, 664
AluBI AGCT 5 cut(s) 124, 206, 243, 349, 926
AluI AGCT 5 cut(s) 124, 206, 243, 349, 926
Alw26I GTCTC 1 cut(s) 938
AlwI GGATC 1 cut(s) 359
AoxI GGCC 1 cut(s) 537
ApeKI GCWGC 1 cut(s) 811
ApoI RAATTY 2 cut(s) 625, 640
AseI ATTAAT 1 cut(s) 744
Asp700I GAANNNNTTC 2 cut(s) 312, 640
AsuC2I CCSGG 2 cut(s) 110, 792
AsuHPI GGTGA 4 cut(s) 428, 461, 761, 761
BauI CACGAG 1 cut(s) 102
BbsI GAAGAC 1 cut(s) 894
BbvI GCAGC 1 cut(s) 798
BccI CCATC 2 cut(s) 407, 674
BclI TGATCA 2 cut(s) 586, 973
BcnI CCSGG 2 cut(s) 110, 792
BcoDI GTCTC 1 cut(s) 938
BcuI ACTAGT 1 cut(s) 940
BfaI CTAG 1 cut(s) 941
BfmI CTRYAG 2 cut(s) 87, 812
BglII AGATCT 2 cut(s) 35, 988
BisI GCNGC 1 cut(s) 812
BlpI GCTNAGC 1 cut(s) 350
BlsI GCNGC 1 cut(s) 813
Bme1390I CCNGG 2 cut(s) 110, 792
BmrFI CCNGG 2 cut(s) 110, 792
BmsI GCATC 2 cut(s) 586, 784
BpiI GAAGAC 1 cut(s) 894
Bpu1102I GCTNAGC 1 cut(s) 350
BpuMI CCSGG 2 cut(s) 110, 792
Bsa29I ATCGAT 1 cut(s) 229
BsaI GGTCTC 1 cut(s) 938
BsaJI CCNNGG 1 cut(s) 791
BsaXI ACNNNNNCTCC 2 cut(s) 429, 459
Bsc4I CCNNNNNNNGG 1 cut(s) 287
Bse1I ACTGG 1 cut(s) 99
Bse3DI GCAATG 1 cut(s) 361
BseCI ATCGAT 1 cut(s) 229
BseDI CCNNGG 1 cut(s) 791
BseGI GGATG 2 cut(s) 577, 685
BseLI CCNNNNNNNGG 1 cut(s) 287
BseMI GCAATG 1 cut(s) 361
BseMII CTCAG 2 cut(s) 341, 530
BseNI ACTGG 1 cut(s) 99
BseXI GCAGC 1 cut(s) 798
BseYI CCCAGC 1 cut(s) 432
Bsh1236I CGCG 1 cut(s) 722
BshFI GGCC 1 cut(s) 539
BshVI ATCGAT 1 cut(s) 229
BsiSI CCGG 3 cut(s) 109, 540, 791
BslFI GGGAC 2 cut(s) 419, 864
BslI CCNNNNNNNGG 1 cut(s) 287
BsmAI GTCTC 1 cut(s) 938
BsmFI GGGAC 2 cut(s) 419, 864
BsnI GGCC 1 cut(s) 539
Bso31I GGTCTC 1 cut(s) 938
Bsp143I GATC 6 cut(s) 35, 364, 521, 586, 973, 988
Bsp1720I GCTNAGC 1 cut(s) 350
BspACI CCGC 1 cut(s) 502
BspANI GGCC 1 cut(s) 539
BspCNI CTCAG 2 cut(s) 342, 529
BspDI ATCGAT 1 cut(s) 229
BspFNI CGCG 1 cut(s) 722
BspHI TCATGA 1 cut(s) 589
BspMAI CTGCAG 1 cut(s) 816
BspPI GGATC 1 cut(s) 359
BspQI GCTCTTC 1 cut(s) 858
BspTNI GGTCTC 1 cut(s) 938
BsrDI GCAATG 1 cut(s) 361
BsrI ACTGG 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 791
BssMI GATC 6 cut(s) 35, 364, 521, 586, 973, 988
BssNAI GTATAC 1 cut(s) 946
BssSI CACGAG 1 cut(s) 102
Bst1107I GTATAC 1 cut(s) 946
Bst2BI CACGAG 1 cut(s) 102
Bst4CI ACNGT 3 cut(s) 196, 535, 855
Bst6I CTCTTC 4 cut(s) 26, 318, 447, 858
BstDEI CTNAG 4 cut(s) 78, 350, 516, 982
BstF5I GGATG 2 cut(s) 577, 685
BstFNI CGCG 1 cut(s) 722
BstKTI GATC 6 cut(s) 38, 367, 524, 589, 976, 991
BstMAI GTCTC 1 cut(s) 938
BstMBI GATC 6 cut(s) 35, 364, 521, 586, 973, 988
BstMWI GCNNNNNNNGC 2 cut(s) 508, 659
BstSCI CCNGG 2 cut(s) 108, 790
BstSFI CTRYAG 2 cut(s) 87, 812
BstUI CGCG 1 cut(s) 722
BstV1I GCAGC 1 cut(s) 798
BstV2I GAAGAC 1 cut(s) 894
BstX2I RGATCY 2 cut(s) 35, 988
BstYI RGATCY 2 cut(s) 35, 988
BstZ17I GTATAC 1 cut(s) 946
Bsu15I ATCGAT 1 cut(s) 229
BsuRI GGCC 1 cut(s) 539
BsuTUI ATCGAT 1 cut(s) 229
BtsCI GGATG 2 cut(s) 577, 685
BtsI GCAGTG 1 cut(s) 471
BtsIMutI CAGTG 3 cut(s) 471, 540, 637
CciI TCATGA 1 cut(s) 589
ClaI ATCGAT 1 cut(s) 229
CspCI CAANNNNNGTGG 2 cut(s) 900, 935
CviAII CATG 8 cut(s) 67, 119, 154, 284, 590, 676, 728, 803
DdeI CTNAG 4 cut(s) 78, 350, 516, 982
DpnI GATC 6 cut(s) 37, 366, 523, 588, 975, 990
DpnII GATC 6 cut(s) 35, 364, 521, 586, 973, 988
EaeI YGGCCR 1 cut(s) 537
Eam1104I CTCTTC 4 cut(s) 26, 318, 447, 858
EarI CTCTTC 4 cut(s) 26, 318, 447, 858
Eco31I GGTCTC 1 cut(s) 938
EcoRI GAATTC 1 cut(s) 640
EcoT22I ATGCAT 1 cut(s) 120
FaeI CATG 8 cut(s) 70, 122, 157, 287, 593, 679, 731, 806
FalI AAGNNNNNCTT 4 cut(s) 297, 329, 855, 887
FaqI GGGAC 2 cut(s) 419, 864
FatI CATG 8 cut(s) 66, 118, 153, 283, 589, 675, 727, 802
FbaI TGATCA 2 cut(s) 586, 973
FblI GTMKAC 2 cut(s) 738, 945
Fnu4HI GCNGC 1 cut(s) 812
FokI GGATG 2 cut(s) 564, 692
Fsp4HI GCNGC 1 cut(s) 812
FspBI CTAG 1 cut(s) 941
GluI GCNGC 1 cut(s) 812
GsaI CCCAGC 1 cut(s) 436
HaeIII GGCC 1 cut(s) 539
HapII CCGG 3 cut(s) 109, 540, 791
Hin1II CATG 8 cut(s) 70, 122, 157, 287, 593, 679, 731, 806
HindIII AAGCTT 1 cut(s) 924
HinfI GANTC 7 cut(s) 4, 82, 98, 419, 425, 514, 735
HpaII CCGG 3 cut(s) 109, 540, 791
HphI GGTGA 4 cut(s) 428, 461, 761, 761
Hpy166II GTNNAC 3 cut(s) 739, 769, 946
Hpy188I TCNGA 5 cut(s) 60, 424, 519, 734, 832
Hpy188III TCNNGA 4 cut(s) 18, 590, 645, 1005
Hpy8I GTNNAC 3 cut(s) 739, 769, 946
Hpy99I CGWCG 1 cut(s) 532
HpyAV CCTTC 3 cut(s) 230, 281, 478
HpyCH4III ACNGT 3 cut(s) 196, 535, 855
HpyCH4V TGCA 3 cut(s) 118, 304, 814
HpyF10VI GCNNNNNNNGC 2 cut(s) 508, 659
HpyF3I CTNAG 4 cut(s) 78, 350, 516, 982
Hsp92II CATG 8 cut(s) 70, 122, 157, 287, 593, 679, 731, 806
Ksp22I TGATCA 2 cut(s) 586, 973
Kzo9I GATC 6 cut(s) 35, 364, 521, 586, 973, 988
LguI GCTCTTC 1 cut(s) 858
Lsp1109I GCAGC 1 cut(s) 798
LweI GCATC 2 cut(s) 586, 784
MaeI CTAG 1 cut(s) 941
MalI GATC 6 cut(s) 37, 366, 523, 588, 975, 990
MboI GATC 6 cut(s) 35, 364, 521, 586, 973, 988
MboII GAAGA 9 cut(s) 43, 305, 464, 470, 505, 508, 875, 894, 983
MfeI CAATTG 1 cut(s) 219
MflI RGATCY 2 cut(s) 35, 988
MluCI AATT 8 cut(s) 41, 171, 180, 219, 565, 625, 640, 995
MluI ACGCGT 1 cut(s) 720
MlyI GAGTC 2 cut(s) 508, 744
MmeI TCCRAC 3 cut(s) 452, 605, 961
MnlI CCTC 9 cut(s) 130, 170, 396, 448, 474, 483, 498, 630, 831
Mph1103I ATGCAT 1 cut(s) 120
MroXI GAANNNNTTC 2 cut(s) 312, 640
MseI TTAA 2 cut(s) 612, 744
MspI CCGG 3 cut(s) 109, 540, 791
MspR9I CCNGG 2 cut(s) 110, 792
MunI CAATTG 1 cut(s) 219
MvnI CGCG 1 cut(s) 722
MwoI GCNNNNNNNGC 2 cut(s) 508, 659
NciI CCSGG 2 cut(s) 110, 792
NdeII GATC 6 cut(s) 35, 364, 521, 586, 973, 988
NlaIII CATG 8 cut(s) 70, 122, 157, 287, 593, 679, 731, 806
NsiI ATGCAT 1 cut(s) 120
PagI TCATGA 1 cut(s) 589
PciSI GCTCTTC 1 cut(s) 858
PdmI GAANNNNTTC 2 cut(s) 312, 640
PfeI GAWTC 5 cut(s) 4, 82, 98, 419, 425
PfoI TCCNGGA 1 cut(s) 108
PkrI GCNGC 1 cut(s) 813
PleI GAGTC 2 cut(s) 508, 743
PpsI GAGTC 2 cut(s) 508, 743
PshBI ATTAAT 1 cut(s) 744
PsiI TTATAA 1 cut(s) 702
PspFI CCCAGC 1 cut(s) 432
PstI CTGCAG 1 cut(s) 816
PsuI RGATCY 2 cut(s) 35, 988
SapI GCTCTTC 1 cut(s) 858
SaqAI TTAA 2 cut(s) 612, 744
SatI GCNGC 1 cut(s) 812
Sau3AI GATC 6 cut(s) 35, 364, 521, 586, 973, 988
SchI GAGTC 2 cut(s) 508, 744
ScrFI CCNGG 2 cut(s) 110, 792
SetI ASST 9 cut(s) 126, 208, 241, 245, 272, 351, 509, 695, 928
SfaNI GCATC 2 cut(s) 586, 784
SfcI CTRYAG 2 cut(s) 87, 812
SpeI ACTAGT 1 cut(s) 940
Sse9I AATT 8 cut(s) 41, 171, 180, 219, 565, 625, 640, 995
SsiI CCGC 1 cut(s) 502
SspI AATATT 3 cut(s) 24, 550, 759
SspMI CTAG 1 cut(s) 941
StyD4I CCNGG 2 cut(s) 108, 790
TaaI ACNGT 3 cut(s) 196, 535, 855
TaqI TCGA 2 cut(s) 229, 644
TasI AATT 8 cut(s) 41, 171, 180, 219, 565, 625, 640, 995
TfiI GAWTC 5 cut(s) 4, 82, 98, 419, 425
Tru1I TTAA 2 cut(s) 612, 744
Tru9I TTAA 2 cut(s) 612, 744
TscAI CASTG 3 cut(s) 471, 540, 637
TseI GCWGC 1 cut(s) 811
TspDTI ATGAA 7 cut(s) 17, 44, 83, 300, 716, 768, 876
TspGWI ACGGA 1 cut(s) 423
TspRI CASTG 3 cut(s) 471, 540, 637
VspI ATTAAT 1 cut(s) 744
XapI RAATTY 2 cut(s) 625, 640
XmiI GTMKAC 2 cut(s) 738, 945
XmnI GAANNNNTTC 2 cut(s) 312, 640
XspI CTAG 1 cut(s) 941
Zsp2I ATGCAT 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.