pycom04g17980

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
20146902 .. 20148369
1468 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g17980.2

Sequence Viewer

Length: 228 bp
ATGGCGTGCCTTGTCTCGACGACCCTCTCTCTCCCTCTCTCTGCTTCCCATAGCTTTGAAAAGGGAACAGCTCCAAGAAGATTATCACTTGTGGTCAGACTTTCAAGCCAACCAATTTCAGAAACAGCTGCAAAGCCTTCCGCCTCCAGCAGTACAAATAAAGCCATGTCAACTTCGAATCGGAGTTGTCAAGATCGATCTTCGGACACCCTCAAAACTTCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

7.91

Weight (kDa)

10.05

Isoelectric Point (pI)

69.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017682)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g06210
malus_domestica MD12G1217200.v1.1
prunus_persica Prupe.6G323500_v2.0.a1
pyrus_communis pycom04g17980 pycom12g20270
rosa_chinensis RchiOBHm_Chr3g0455231
rosa_laevigata RLG00000025375
rosa_multiflora Rmu_sc0002169.1_g000033
rosa_roxburghii Rroxscaffold_6G00424450
rosa_samantha Rh3AG065400 Rh3CG066000 Rh3DG067600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 141
AfaI GTAC 1 cut(s) 154
AgsI TTSAA 2 cut(s) 59, 105
AluBI AGCT 3 cut(s) 54, 71, 128
AluI AGCT 3 cut(s) 54, 71, 128
Alw26I GTCTC 1 cut(s) 19
ApeKI GCWGC 1 cut(s) 128
AsuII TTCGAA 1 cut(s) 176
BbvI GCAGC 1 cut(s) 115
BcoDI GTCTC 1 cut(s) 19
BisI GCNGC 1 cut(s) 129
BlsI GCNGC 1 cut(s) 130
BpmI CTGGAG 1 cut(s) 130
Bpu14I TTCGAA 1 cut(s) 176
Bsa29I ATCGAT 1 cut(s) 196
BseCI ATCGAT 1 cut(s) 196
BseXI GCAGC 1 cut(s) 115
BshVI ATCGAT 1 cut(s) 196
BsmAI GTCTC 1 cut(s) 19
Bsp119I TTCGAA 1 cut(s) 176
Bsp143I GATC 2 cut(s) 193, 197
BspACI CCGC 1 cut(s) 141
BspDI ATCGAT 1 cut(s) 196
BspT104I TTCGAA 1 cut(s) 176
BssMI GATC 2 cut(s) 193, 197
BstBI TTCGAA 1 cut(s) 176
BstC8I GCNNGC 1 cut(s) 7
BstKTI GATC 2 cut(s) 196, 200
BstMAI GTCTC 1 cut(s) 19
BstMBI GATC 2 cut(s) 193, 197
BstV1I GCAGC 1 cut(s) 115
Bsu15I ATCGAT 1 cut(s) 196
BsuTUI ATCGAT 1 cut(s) 196
Cac8I GCNNGC 1 cut(s) 7
ClaI ATCGAT 1 cut(s) 196
Csp6I GTAC 1 cut(s) 153
CviAII CATG 1 cut(s) 166
CviJI RGCY 6 cut(s) 54, 71, 108, 128, 136, 164
CviKI_1 RGCY 6 cut(s) 54, 71, 108, 128, 136, 164
CviQI GTAC 1 cut(s) 153
DpnI GATC 2 cut(s) 195, 199
DpnII GATC 2 cut(s) 193, 197
EciI GGCGGA 1 cut(s) 130
FaeI CATG 1 cut(s) 169
FaiI YATR 2 cut(s) 51, 167
FatI CATG 1 cut(s) 165
Fnu4HI GCNGC 1 cut(s) 129
Fsp4HI GCNGC 1 cut(s) 129
GluI GCNGC 1 cut(s) 129
GsuI CTGGAG 1 cut(s) 130
Hin1II CATG 1 cut(s) 169
HincII GTYRAC 1 cut(s) 171
HindII GTYRAC 1 cut(s) 171
HinfI GANTC 1 cut(s) 178
Hpy166II GTNNAC 1 cut(s) 171
Hpy188I TCNGA 4 cut(s) 98, 121, 183, 205
Hpy188III TCNNGA 2 cut(s) 16, 191
Hpy8I GTNNAC 1 cut(s) 171
Hpy99I CGWCG 1 cut(s) 22
HpyAV CCTTC 1 cut(s) 147
HpyCH4V TGCA 1 cut(s) 131
Hsp92II CATG 1 cut(s) 169
Kzo9I GATC 2 cut(s) 193, 197
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 1 cut(s) 160
Lsp1109I GCAGC 1 cut(s) 115
MalI GATC 2 cut(s) 195, 199
MboI GATC 2 cut(s) 193, 197
MboII GAAGA 2 cut(s) 90, 192
MluCI AATT 1 cut(s) 114
MnlI CCTC 4 cut(s) 35, 45, 154, 221
MspA1I CMGCKG 1 cut(s) 128
NdeII GATC 2 cut(s) 193, 197
NlaIII CATG 1 cut(s) 169
NspV TTCGAA 1 cut(s) 176
PfeI GAWTC 1 cut(s) 178
PkrI GCNGC 1 cut(s) 130
PvuII CAGCTG 1 cut(s) 128
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
SatI GCNGC 1 cut(s) 129
Sau3AI GATC 2 cut(s) 193, 197
SetI ASST 3 cut(s) 56, 73, 130
SfuI TTCGAA 1 cut(s) 176
SgeI CNNG 9 cut(s) 18, 23, 28, 87, 101, 117, 159, 178, 203
Sse9I AATT 1 cut(s) 114
SsiI CCGC 1 cut(s) 141
TaqI TCGA 3 cut(s) 17, 176, 196
TasI AATT 1 cut(s) 114
TatI WGTACW 1 cut(s) 152
TfiI GAWTC 1 cut(s) 178
TseI GCWGC 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.