Rmu_sc0002169.1_g000033

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002169.1
Physical Location & Seq
Forward (+)
176481 .. 178465
1985 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002169.1_g000033.1.cds

Sequence Viewer

Length: 348 bp
atggcgagcctcgtcgccatgaccttttctatacctctctctgctttgcataccttcactaatgaagtacctctggcaaaatcagctctggttagagtttcaagccgaagagtttcgggatcagcctcaaggccttctgcctcatgcaatacaaatggagtcgtatcatctttgaatcaaagctgtcaacatcttcttacaacaacctcaaaacctctcttggaaatcttgtattgtcataggagtatagaatcttgtagtcagatgatcatatttggttattgggtaggacctgatattgatgatggttatggctatgtggaagcttttgttaatcaaattacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.45

Weight (kDa)

6.8

Isoelectric Point (pI)

44.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017682)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g06210
malus_domestica MD12G1217200.v1.1
prunus_persica Prupe.6G323500_v2.0.a1
pyrus_communis pycom04g17980 pycom12g20270
rosa_chinensis RchiOBHm_Chr3g0455231
rosa_laevigata RLG00000025375
rosa_multiflora Rmu_sc0002169.1_g000033
rosa_roxburghii Rroxscaffold_6G00424450
rosa_samantha Rh3AG065400 Rh3CG066000 Rh3DG067600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 127
AfaI GTAC 1 cut(s) 69
AgsI TTSAA 2 cut(s) 102, 175
AluBI AGCT 3 cut(s) 86, 183, 326
AluI AGCT 3 cut(s) 86, 183, 326
AlwI GGATC 1 cut(s) 127
AoxI GGCC 1 cut(s) 131
Asp700I GAANNNNTTC 1 cut(s) 112
AspS9I GGNCC 1 cut(s) 290
AvaII GGWCC 1 cut(s) 290
BccI CCATC 1 cut(s) 299
BclI TGATCA 1 cut(s) 267
Bme18I GGWCC 1 cut(s) 290
BmgT120I GGNCC 1 cut(s) 290
BpuEI CTTGAG 1 cut(s) 112
BshFI GGCC 1 cut(s) 133
BsnI GGCC 1 cut(s) 133
Bsp143I GATC 2 cut(s) 119, 267
BspANI GGCC 1 cut(s) 133
BspPI GGATC 1 cut(s) 127
BssMI GATC 2 cut(s) 119, 267
Bst6I CTCTTC 1 cut(s) 103
BstC8I GCNNGC 1 cut(s) 7
BstKTI GATC 2 cut(s) 122, 270
BstMBI GATC 2 cut(s) 119, 267
BstMWI GCNNNNNNNGC 1 cut(s) 83
BsuRI GGCC 1 cut(s) 133
Cac8I GCNNGC 1 cut(s) 7
Cfr13I GGNCC 1 cut(s) 290
Csp6I GTAC 1 cut(s) 68
CviAII CATG 2 cut(s) 19, 144
CviJI RGCY 8 cut(s) 9, 86, 105, 125, 133, 183, 315, 326
CviKI_1 RGCY 8 cut(s) 9, 86, 105, 125, 133, 183, 315, 326
CviQI GTAC 1 cut(s) 68
DpnI GATC 2 cut(s) 121, 269
DpnII GATC 2 cut(s) 119, 267
Eam1104I CTCTTC 1 cut(s) 103
EarI CTCTTC 1 cut(s) 103
Eco147I AGGCCT 1 cut(s) 133
Eco47I GGWCC 1 cut(s) 290
EcoO109I RGGNCCY 1 cut(s) 290
FaeI CATG 2 cut(s) 22, 147
FaiI YATR 9 cut(s) 20, 32, 51, 145, 240, 248, 272, 312, 318
FatI CATG 2 cut(s) 18, 143
FbaI TGATCA 1 cut(s) 267
HaeIII GGCC 1 cut(s) 133
Hin1II CATG 2 cut(s) 22, 147
HincII GTYRAC 1 cut(s) 188
HindII GTYRAC 1 cut(s) 188
HindIII AAGCTT 1 cut(s) 324
HinfI GANTC 3 cut(s) 159, 175, 251
Hpy166II GTNNAC 1 cut(s) 188
Hpy188I TCNGA 1 cut(s) 264
Hpy188III TCNNGA 1 cut(s) 117
Hpy8I GTNNAC 1 cut(s) 188
Hpy99I CGWCG 1 cut(s) 17
HpyAV CCTTC 2 cut(s) 64, 144
HpyCH4V TGCA 2 cut(s) 49, 147
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
Hsp92II CATG 2 cut(s) 22, 147
Ksp22I TGATCA 1 cut(s) 267
Kzo9I GATC 2 cut(s) 119, 267
LpnPI CCDG 3 cut(s) 59, 74, 306
MalI GATC 2 cut(s) 121, 269
MboI GATC 2 cut(s) 119, 267
MboII GAAGA 2 cut(s) 120, 185
MluCI AATT 1 cut(s) 339
MlyI GAGTC 1 cut(s) 168
MnlI CCTC 7 cut(s) 20, 45, 81, 136, 151, 217, 225
MroXI GAANNNNTTC 1 cut(s) 112
MseI TTAA 1 cut(s) 333
MwoI GCNNNNNNNGC 1 cut(s) 83
NdeII GATC 2 cut(s) 119, 267
NlaIII CATG 2 cut(s) 22, 147
PceI AGGCCT 1 cut(s) 133
PdmI GAANNNNTTC 1 cut(s) 112
PfeI GAWTC 2 cut(s) 175, 251
PleI GAGTC 1 cut(s) 167
PpsI GAGTC 1 cut(s) 167
PpuMI RGGWCCY 1 cut(s) 290
Psp5II RGGWCCY 1 cut(s) 290
PspPI GGNCC 1 cut(s) 290
PspPPI RGGWCCY 1 cut(s) 290
RsaI GTAC 1 cut(s) 69
RsaNI GTAC 1 cut(s) 68
SaqAI TTAA 1 cut(s) 333
Sau3AI GATC 2 cut(s) 119, 267
Sau96I GGNCC 1 cut(s) 290
SchI GAGTC 1 cut(s) 168
SinI GGWCC 1 cut(s) 290
SmlI CTYRAG 1 cut(s) 127
SmoI CTYRAG 1 cut(s) 127
Sse9I AATT 1 cut(s) 339
SseBI AGGCCT 1 cut(s) 133
StuI AGGCCT 1 cut(s) 133
TasI AATT 1 cut(s) 339
TfiI GAWTC 2 cut(s) 175, 251
Tru1I TTAA 1 cut(s) 333
Tru9I TTAA 1 cut(s) 333
TspDTI ATGAA 1 cut(s) 78
VpaK11BI GGWCC 1 cut(s) 290
XmnI GAANNNNTTC 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.