pycom05g10160

aminoacylase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0021259
Physical Location & Seq
Forward (+)
13522086 .. 13523595
1510 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g10160.3

Sequence Viewer

Length: 270 bp
ATGGATAAACCGAGGCCTATAGATTTCAACTGCCTCACAATCGCCGCCAGAGAGGTCAGATTGTCCAGAGCGCTGCCTTTTCCTCCGCCAACACCGTTGTGTCAGATGTTAAGCTGCGGCTCCAGGAAGACCACAGCAATGGCTTCAATCCCATCCTCCACTTTTGCTTCTGGATCGACTTGGGGAAAGAACGGAGGAGAGCACAAGCATTATGAATTTATTTGCTATAGAGTTTGTCAGGGAGAAAGATCACGAACGAAAGAAATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.92

Weight (kDa)

9.4

Isoelectric Point (pI)

41.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021259)

Species Orthologous Gene IDs
pyrus_communis pycom04g01120 pycom05g10160 pycom05g25620 pycom09g06480 pycom10g20690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 45, 86, 117
AclWI GGATC 1 cut(s) 181
AcsI RAATTY 1 cut(s) 215
AfeI AGCGCT 1 cut(s) 72
AgsI TTSAA 2 cut(s) 28, 147
AjnI CCWGG 1 cut(s) 122
AleI CACNNNNGTG 1 cut(s) 97
AluBI AGCT 1 cut(s) 114
AluI AGCT 1 cut(s) 114
Alw21I GWGCWC 1 cut(s) 204
AlwI GGATC 1 cut(s) 181
Aor51HI AGCGCT 1 cut(s) 72
AoxI GGCC 1 cut(s) 14
ApeKI GCWGC 2 cut(s) 73, 114
ApoI RAATTY 1 cut(s) 215
AspLEI GCGC 1 cut(s) 73
BbsI GAAGAC 1 cut(s) 134
Bbv12I GWGCWC 1 cut(s) 204
BbvI GCAGC 2 cut(s) 60, 101
BccI CCATC 1 cut(s) 160
BciT130I CCWGG 1 cut(s) 124
BfmI CTRYAG 2 cut(s) 18, 226
BfoI RGCGCY 1 cut(s) 74
BisI GCNGC 4 cut(s) 45, 74, 115, 118
BlsI GCNGC 4 cut(s) 46, 75, 116, 119
Bme1390I CCNGG 1 cut(s) 124
BmiI GGNNCC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 124
BpiI GAAGAC 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 106
BsaJI CCNNGG 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 144
BseBI CCWGG 1 cut(s) 124
BseDI CCNNGG 1 cut(s) 11
BseGI GGATG 1 cut(s) 152
BseMI GCAATG 1 cut(s) 144
BseRI GAGGAG 1 cut(s) 210
BseXI GCAGC 2 cut(s) 60, 101
BshFI GGCC 1 cut(s) 16
BsiHKAI GWGCWC 1 cut(s) 204
BsnI GGCC 1 cut(s) 16
Bsp1286I GDGCHC 1 cut(s) 204
Bsp143I GATC 2 cut(s) 173, 248
BspACI CCGC 3 cut(s) 45, 86, 117
BspANI GGCC 1 cut(s) 16
BspLI GGNNCC 1 cut(s) 121
BspPI GGATC 1 cut(s) 181
BsrDI GCAATG 1 cut(s) 144
BssECI CCNNGG 1 cut(s) 11
BssMI GATC 2 cut(s) 173, 248
Bst2UI CCWGG 1 cut(s) 124
Bst4CI ACNGT 1 cut(s) 96
BstF5I GGATG 1 cut(s) 152
BstH2I RGCGCY 1 cut(s) 74
BstHHI GCGC 1 cut(s) 73
BstKTI GATC 2 cut(s) 176, 251
BstMBI GATC 2 cut(s) 173, 248
BstNI CCWGG 1 cut(s) 124
BstSCI CCNGG 1 cut(s) 122
BstSFI CTRYAG 2 cut(s) 18, 226
BstV1I GCAGC 2 cut(s) 60, 101
BstV2I GAAGAC 1 cut(s) 134
BstXI CCANNNNNNTGG 1 cut(s) 139
BsuRI GGCC 1 cut(s) 16
BtsCI GGATG 1 cut(s) 152
CfoI GCGC 1 cut(s) 73
CviJI RGCY 4 cut(s) 16, 114, 120, 143
CviKI_1 RGCY 4 cut(s) 16, 114, 120, 143
DpnI GATC 2 cut(s) 175, 250
DpnII GATC 2 cut(s) 173, 248
EciI GGCGGA 1 cut(s) 75
Eco147I AGGCCT 1 cut(s) 16
Eco47III AGCGCT 1 cut(s) 72
EcoRII CCWGG 1 cut(s) 122
FaiI YATR 3 cut(s) 20, 213, 228
Fnu4HI GCNGC 4 cut(s) 45, 74, 115, 118
FokI GGATG 1 cut(s) 139
Fsp4HI GCNGC 4 cut(s) 45, 74, 115, 118
GlaI GCGC 1 cut(s) 72
GluI GCNGC 4 cut(s) 45, 74, 115, 118
GsuI CTGGAG 1 cut(s) 106
HaeII RGCGCY 1 cut(s) 74
HaeIII GGCC 1 cut(s) 16
HhaI GCGC 1 cut(s) 73
Hin6I GCGC 1 cut(s) 71
HinP1I GCGC 1 cut(s) 71
Hpy188I TCNGA 2 cut(s) 59, 105
Hpy188III TCNNGA 3 cut(s) 66, 171, 252
HpyCH4III ACNGT 1 cut(s) 96
HspAI GCGC 1 cut(s) 71
Kzo9I GATC 2 cut(s) 173, 248
LmnI GCTCC 1 cut(s) 125
LpnPI CCDG 6 cut(s) 61, 79, 109, 136, 156, 224
Lsp1109I GCAGC 2 cut(s) 60, 101
MalI GATC 2 cut(s) 175, 250
MboI GATC 2 cut(s) 173, 248
MboII GAAGA 1 cut(s) 139
MhlI GDGCHC 1 cut(s) 204
MluCI AATT 1 cut(s) 215
MnlI CCTC 6 cut(s) 6, 44, 46, 93, 166, 188
MseI TTAA 1 cut(s) 110
MslI CAYNNNNRTG 2 cut(s) 97, 137
MspR9I CCNGG 1 cut(s) 124
MvaI CCWGG 1 cut(s) 124
NdeII GATC 2 cut(s) 173, 248
NlaIV GGNNCC 1 cut(s) 121
OliI CACNNNNGTG 1 cut(s) 97
PceI AGGCCT 1 cut(s) 16
PfoI TCCNGGA 1 cut(s) 122
PkrI GCNGC 4 cut(s) 46, 75, 116, 119
Psp6I CCWGG 1 cut(s) 122
PspGI CCWGG 1 cut(s) 122
PspN4I GGNNCC 1 cut(s) 121
RseI CAYNNNNRTG 2 cut(s) 97, 137
SaqAI TTAA 1 cut(s) 110
SatI GCNGC 4 cut(s) 45, 74, 115, 118
Sau3AI GATC 2 cut(s) 173, 248
ScrFI CCNGG 1 cut(s) 124
SduI GDGCHC 1 cut(s) 204
SetI ASST 2 cut(s) 57, 116
SfcI CTRYAG 2 cut(s) 18, 226
SmiMI CAYNNNNRTG 2 cut(s) 97, 137
Sse9I AATT 1 cut(s) 215
SseBI AGGCCT 1 cut(s) 16
SsiI CCGC 3 cut(s) 45, 86, 117
StuI AGGCCT 1 cut(s) 16
StyD4I CCNGG 1 cut(s) 122
TaaI ACNGT 1 cut(s) 96
TaqI TCGA 1 cut(s) 176
TasI AATT 1 cut(s) 215
TauI GCSGC 2 cut(s) 47, 120
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TseI GCWGC 2 cut(s) 73, 114
TspDTI ATGAA 1 cut(s) 228
TspGWI ACGGA 1 cut(s) 207
XapI RAATTY 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.