pycom07g00390

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
383478 .. 383702
225 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g00390.1

Sequence Viewer

Length: 225 bp
ATGGTTGCTGGAATTCAATCTGACAAAGGGAAATCACTTGTTCTTGATCGAGTTCAACCAAGGTCCTCCTCTGATCCATCTTTCAGGCACAATGGAGGATCCAGTTTTGCTAATTCCAATTATAATACTGAAGATCTTACAACAATGGGAATTACCACAACTTTGGCAATTATAAGGGTAACAATTTCAGGGGCAAAGGGAGAGGCAGATTTCAATACAATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

7.85

Weight (kDa)

6.53

Isoelectric Point (pI)

28.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022544)

Species Orthologous Gene IDs
pyrus_communis pycom07g00390 pycom07g24750 pycom08g04260 pycom12g17440

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 123, 173
AclWI GGATC 3 cut(s) 68, 93, 106
AcsI RAATTY 1 cut(s) 12
AcuI CTGAAG 1 cut(s) 150
AgsI TTSAA 3 cut(s) 17, 56, 214
AlwI GGATC 3 cut(s) 68, 93, 106
ApoI RAATTY 1 cut(s) 12
AspS9I GGNCC 1 cut(s) 63
AvaII GGWCC 1 cut(s) 63
BamHI GGATCC 1 cut(s) 98
BccI CCATC 1 cut(s) 85
BglII AGATCT 1 cut(s) 133
Bme18I GGWCC 1 cut(s) 63
BmgT120I GGNCC 1 cut(s) 63
BmiI GGNNCC 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 59
Bse1I ACTGG 1 cut(s) 102
BseDI CCNNGG 1 cut(s) 59
BseNI ACTGG 1 cut(s) 102
BseRI GAGGAG 1 cut(s) 58
Bsp143I GATC 4 cut(s) 46, 73, 98, 133
BspLI GGNNCC 1 cut(s) 100
BspPI GGATC 3 cut(s) 68, 93, 106
BsrI ACTGG 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 59
BssMI GATC 4 cut(s) 46, 73, 98, 133
BssT1I CCWWGG 1 cut(s) 59
BstKTI GATC 4 cut(s) 49, 76, 101, 136
BstMBI GATC 4 cut(s) 46, 73, 98, 133
BstX2I RGATCY 2 cut(s) 98, 133
BstXI CCANNNNNNTGG 1 cut(s) 163
BstYI RGATCY 2 cut(s) 98, 133
Cfr13I GGNCC 1 cut(s) 63
DpnI GATC 4 cut(s) 48, 75, 100, 135
DpnII GATC 4 cut(s) 46, 73, 98, 133
Eco130I CCWWGG 1 cut(s) 59
Eco47I GGWCC 1 cut(s) 63
Eco57I CTGAAG 1 cut(s) 150
EcoO109I RGGNCCY 1 cut(s) 63
EcoRI GAATTC 1 cut(s) 12
EcoT14I CCWWGG 1 cut(s) 59
ErhI CCWWGG 1 cut(s) 59
FaiI YATR 2 cut(s) 123, 173
Hpy188I TCNGA 2 cut(s) 22, 73
Hpy188III TCNNGA 1 cut(s) 44
Kzo9I GATC 4 cut(s) 46, 73, 98, 133
LpnPI CCDG 3 cut(s) 70, 115, 174
MaeIII GTNAC 1 cut(s) 178
MalI GATC 4 cut(s) 48, 75, 100, 135
MboI GATC 4 cut(s) 46, 73, 98, 133
MboII GAAGA 1 cut(s) 143
MflI RGATCY 2 cut(s) 98, 133
MluCI AATT 7 cut(s) 12, 112, 118, 150, 168, 183, 219
MnlI CCTC 4 cut(s) 76, 79, 89, 196
NdeII GATC 4 cut(s) 46, 73, 98, 133
NlaIV GGNNCC 1 cut(s) 100
PpuMI RGGWCCY 1 cut(s) 63
PsiI TTATAA 2 cut(s) 123, 173
Psp5II RGGWCCY 1 cut(s) 63
PspN4I GGNNCC 1 cut(s) 100
PspPI GGNCC 1 cut(s) 63
PspPPI RGGWCCY 1 cut(s) 63
PsuI RGATCY 2 cut(s) 98, 133
Sau3AI GATC 4 cut(s) 46, 73, 98, 133
Sau96I GGNCC 1 cut(s) 63
SetI ASST 1 cut(s) 65
SgeI CNNG 8 cut(s) 21, 50, 56, 62, 72, 97, 114, 201
SinI GGWCC 1 cut(s) 63
Sse9I AATT 7 cut(s) 12, 112, 118, 150, 168, 183, 219
StyI CCWWGG 1 cut(s) 59
TaqI TCGA 1 cut(s) 49
TasI AATT 7 cut(s) 12, 112, 118, 150, 168, 183, 219
VpaK11BI GGWCC 1 cut(s) 63
XapI RAATTY 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.