pycom07g24750
RLK Family

Cysteine-rich RLK (RECEPTOR-like protein kinase) 8

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
25333410 .. 25333754
345 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g24750.1

Sequence Viewer

Length: 345 bp
ATGGCAGAAGAAGCTATCATTGATCAGTCTTTTGACAGTTCTTCCGGATTGTCCTTTGGTAGTGCCATGGTTGCTGGAATTCAATCTGACAAAGGGAAAACACTTGTTCTTGATCAAGATCAATCAAGGTCCTCATCTGATCCATCTTTCAGGCACAATGGAGGATCCAGTTTTGCTAATTCCAATCATAATACTGGATTTTACAACAATGAGAGTTACCACAACTTTGGCAACTATAAGGGTAACAATTTCAAGGGCAAAGGGAAAGGCAGATTCCAATACAATTCAGGTCCCAGATTTTCCAATGGTAATCCCGGCATTCTTGGTACTCTAAAGCCATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

115

Amino Acids

12.3

Weight (kDa)

8.96

Isoelectric Point (pI)

39.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022544)

Species Orthologous Gene IDs
pyrus_communis pycom07g00390 pycom07g24750 pycom08g04260 pycom12g17440

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 44
AclWI GGATC 3 cut(s) 134, 159, 172
AcsI RAATTY 1 cut(s) 78
AfaI GTAC 1 cut(s) 328
AgsI TTSAA 2 cut(s) 83, 253
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
AlwI GGATC 3 cut(s) 134, 159, 172
Aor13HI TCCGGA 1 cut(s) 44
ApoI RAATTY 1 cut(s) 78
AspS9I GGNCC 2 cut(s) 129, 290
AsuC2I CCSGG 1 cut(s) 315
AvaII GGWCC 2 cut(s) 129, 290
BamHI GGATCC 1 cut(s) 164
BccI CCATC 1 cut(s) 151
BclI TGATCA 2 cut(s) 22, 112
BcnI CCSGG 1 cut(s) 315
Bme1390I CCNGG 1 cut(s) 315
Bme18I GGWCC 2 cut(s) 129, 290
BmgT120I GGNCC 2 cut(s) 129, 290
BmiI GGNNCC 2 cut(s) 166, 292
BmrFI CCNGG 1 cut(s) 315
BpuMI CCSGG 1 cut(s) 315
BsaBI GATNNNNATC 1 cut(s) 117
BsaJI CCNNGG 1 cut(s) 66
BsaWI WCCGGW 1 cut(s) 44
Bse1I ACTGG 2 cut(s) 168, 199
Bse8I GATNNNNATC 1 cut(s) 117
BseAI TCCGGA 1 cut(s) 44
BseDI CCNNGG 1 cut(s) 66
BseJI GATNNNNATC 1 cut(s) 117
BseNI ACTGG 2 cut(s) 168, 199
BsiSI CCGG 2 cut(s) 45, 315
BslFI GGGAC 1 cut(s) 276
BsmFI GGGAC 1 cut(s) 276
BsmI GAATGC 1 cut(s) 318
Bsp13I TCCGGA 1 cut(s) 44
Bsp143I GATC 5 cut(s) 22, 112, 118, 139, 164
Bsp19I CCATGG 1 cut(s) 66
BspEI TCCGGA 1 cut(s) 44
BspLI GGNNCC 2 cut(s) 166, 292
BspPI GGATC 3 cut(s) 134, 159, 172
BsrI ACTGG 2 cut(s) 168, 199
BssECI CCNNGG 1 cut(s) 66
BssMI GATC 5 cut(s) 22, 112, 118, 139, 164
BssT1I CCWWGG 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 38
BstDSI CCRYGG 1 cut(s) 66
BstKTI GATC 5 cut(s) 25, 115, 121, 142, 167
BstMBI GATC 5 cut(s) 22, 112, 118, 139, 164
BstMWI GCNNNNNNNGC 2 cut(s) 11, 71
BstSCI CCNGG 1 cut(s) 313
BstX2I RGATCY 1 cut(s) 164
BstXI CCANNNNNNTGG 1 cut(s) 227
BstYI RGATCY 1 cut(s) 164
BtgI CCRYGG 1 cut(s) 66
Cfr13I GGNCC 2 cut(s) 129, 290
Csp6I GTAC 1 cut(s) 327
CviAII CATG 1 cut(s) 67
CviJI RGCY 2 cut(s) 14, 337
CviKI_1 RGCY 2 cut(s) 14, 337
CviQI GTAC 1 cut(s) 327
DpnI GATC 5 cut(s) 24, 114, 120, 141, 166
DpnII GATC 5 cut(s) 22, 112, 118, 139, 164
Eco130I CCWWGG 1 cut(s) 66
Eco47I GGWCC 2 cut(s) 129, 290
EcoO109I RGGNCCY 2 cut(s) 129, 290
EcoRI GAATTC 1 cut(s) 78
EcoT14I CCWWGG 1 cut(s) 66
ErhI CCWWGG 1 cut(s) 66
FaeI CATG 1 cut(s) 70
FaiI YATR 4 cut(s) 68, 189, 237, 340
FaqI GGGAC 1 cut(s) 276
FatI CATG 1 cut(s) 66
FbaI TGATCA 2 cut(s) 22, 112
HapII CCGG 2 cut(s) 45, 315
Hin1II CATG 1 cut(s) 70
HinfI GANTC 1 cut(s) 273
HpaII CCGG 2 cut(s) 45, 315
Hpy188I TCNGA 2 cut(s) 88, 139
Hpy188III TCNNGA 3 cut(s) 45, 110, 116
HpyCH4III ACNGT 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 71
Hsp92II CATG 1 cut(s) 70
Kpn2I TCCGGA 1 cut(s) 44
Ksp22I TGATCA 2 cut(s) 22, 112
Kzo9I GATC 5 cut(s) 22, 112, 118, 139, 164
LpnPI CCDG 8 cut(s) 58, 60, 136, 180, 181, 273, 307, 328
MaeIII GTNAC 2 cut(s) 215, 242
MalI GATC 5 cut(s) 24, 114, 120, 141, 166
MboI GATC 5 cut(s) 22, 112, 118, 139, 164
MboII GAAGA 2 cut(s) 20, 33
MflI RGATCY 1 cut(s) 164
MluCI AATT 4 cut(s) 78, 178, 247, 283
MnlI CCTC 2 cut(s) 142, 155
MroI TCCGGA 1 cut(s) 44
MseI TTAA 1 cut(s) 343
MspI CCGG 2 cut(s) 45, 315
MspR9I CCNGG 1 cut(s) 315
Mva1269I GAATGC 1 cut(s) 318
MwoI GCNNNNNNNGC 2 cut(s) 11, 71
NciI CCSGG 1 cut(s) 315
NcoI CCATGG 1 cut(s) 66
NdeII GATC 5 cut(s) 22, 112, 118, 139, 164
NlaIII CATG 1 cut(s) 70
NlaIV GGNNCC 2 cut(s) 166, 292
PctI GAATGC 1 cut(s) 318
PfeI GAWTC 1 cut(s) 273
PpuMI RGGWCCY 2 cut(s) 129, 290
Psp5II RGGWCCY 2 cut(s) 129, 290
PspN4I GGNNCC 2 cut(s) 166, 292
PspPI GGNCC 2 cut(s) 129, 290
PspPPI RGGWCCY 2 cut(s) 129, 290
PsuI RGATCY 1 cut(s) 164
RsaI GTAC 1 cut(s) 328
RsaNI GTAC 1 cut(s) 327
SaqAI TTAA 1 cut(s) 343
Sau3AI GATC 5 cut(s) 22, 112, 118, 139, 164
Sau96I GGNCC 2 cut(s) 129, 290
ScrFI CCNGG 1 cut(s) 315
SetI ASST 3 cut(s) 16, 131, 292
SinI GGWCC 2 cut(s) 129, 290
Sse9I AATT 4 cut(s) 78, 178, 247, 283
StyD4I CCNGG 1 cut(s) 313
StyI CCWWGG 1 cut(s) 66
TaaI ACNGT 1 cut(s) 38
TasI AATT 4 cut(s) 78, 178, 247, 283
TfiI GAWTC 1 cut(s) 273
Tru1I TTAA 1 cut(s) 343
Tru9I TTAA 1 cut(s) 343
VpaK11BI GGWCC 2 cut(s) 129, 290
XapI RAATTY 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.