Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr9

Orthogroup ID

OG0020972

Physical Location & Seq

Genomic Coordinates Forward (+)

17881800 .. 17882898

Gene Structure 1099 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom09g17390.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 276 bp

ATGAGATGTTCGCAGATCGATGAATCTAGTCATAACCCAATTGATGTTCCAAGGGGGTGGATATGGAATTTGCCAAGACGGACTGTATACTTTGGAACTTCGGTATCAACAATATTCAAAGGTCTATCAACAGAGGGAATTCAATACTGCTTTTGGAGAGGATATGTTTGTGTGAGGGGATTCGAAAGGAAAACAAGAGCACCACGGCCCTTAATGGCCAGATTGCACTTCCCTGCGAGTAAGATGACTAAGACAATAAATGAAGGGAAGAAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0003906 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006139 GO:0006259 GO:0006304 GO:0006305 GO:0006306 GO:0006349 GO:0006725 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009790 GO:0009791 GO:0009793 GO:0009987 GO:0010154 GO:0010468 GO:0016787 GO:0016798 GO:0016799 GO:0019104 GO:0019222 GO:0022414 GO:0032259 GO:0032501 GO:0032502 GO:0034641 GO:0040029 GO:0043076 GO:0043078 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0043414 GO:0044237 GO:0044238 GO:0044260 GO:0044424 GO:0044464 GO:0044728 GO:0046483 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0050789 GO:0060255 GO:0061458 GO:0065007 GO:0071514 GO:0071704 GO:0090304 GO:0140097 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Perm-CXXC RRM_DME

Protein Analysis

92

Amino Acids

10.6

Weight (kDa)

10.29

Isoelectric Point (pI)

30.91

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
RRM_DME	PF15628	7 - 77	1.1e-30	RRM in Demeter

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020972)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G04957
pyrus_communis	pycom09g17390 pycom12g01460
rosa_chinensis	RchiOBHm_Chr6g0267411
rosa_roxburghii	Rroxscaffold_7G00201390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	87
AcoI	YGGCCR	1 cut(s)	216
AcsI	RAATTY	2 cut(s)	67, 138
AgsI	TTSAA	2 cut(s)	118, 143
Alw21I	GWGCWC	1 cut(s)	202
AoxI	GGCC	2 cut(s)	206, 216
ApoI	RAATTY	2 cut(s)	67, 138
AspS9I	GGNCC	1 cut(s)	207
AsuII	TTCGAA	1 cut(s)	183
BaeI	ACNNNNGTAYC	2 cut(s)	87, 120
BalI	TGGCCA	1 cut(s)	218
Bbv12I	GWGCWC	1 cut(s)	202
BceAI	ACGGC	1 cut(s)	221
BfaI	CTAG	1 cut(s)	27
BmgT120I	GGNCC	1 cut(s)	207
Bpu14I	TTCGAA	1 cut(s)	183
Bsa29I	ATCGAT	1 cut(s)	18
BsaJI	CCNNGG	2 cut(s)	50, 203
BseCI	ATCGAT	1 cut(s)	18
BseDI	CCNNGG	2 cut(s)	50, 203
BshFI	GGCC	2 cut(s)	208, 218
BshVI	ATCGAT	1 cut(s)	18
BsiHKAI	GWGCWC	1 cut(s)	202
BsnI	GGCC	2 cut(s)	208, 218
Bsp119I	TTCGAA	1 cut(s)	183
Bsp1286I	GDGCHC	1 cut(s)	202
Bsp143I	GATC	1 cut(s)	15
BspANI	GGCC	2 cut(s)	208, 218
BspDI	ATCGAT	1 cut(s)	18
BspT104I	TTCGAA	1 cut(s)	183
BssECI	CCNNGG	2 cut(s)	50, 203
BssMI	GATC	1 cut(s)	15
BssNAI	GTATAC	1 cut(s)	88
BssT1I	CCWWGG	1 cut(s)	50
Bst1107I	GTATAC	1 cut(s)	88
Bst4CI	ACNGT	1 cut(s)	85
BstBI	TTCGAA	1 cut(s)	183
BstDEI	CTNAG	1 cut(s)	249
BstDSI	CCRYGG	1 cut(s)	203
BstKTI	GATC	1 cut(s)	18
BstMBI	GATC	1 cut(s)	15
BstXI	CCANNNNNNTGG	1 cut(s)	57
BstZ17I	GTATAC	1 cut(s)	88
Bsu15I	ATCGAT	1 cut(s)	18
BsuRI	GGCC	2 cut(s)	208, 218
BsuTUI	ATCGAT	1 cut(s)	18
BtgI	CCRYGG	1 cut(s)	203
Cfr13I	GGNCC	1 cut(s)	207
ClaI	ATCGAT	1 cut(s)	18
CviJI	RGCY	2 cut(s)	208, 218
CviKI_1	RGCY	2 cut(s)	208, 218
DdeI	CTNAG	1 cut(s)	249
DpnI	GATC	1 cut(s)	17
DpnII	GATC	1 cut(s)	15
EaeI	YGGCCR	1 cut(s)	216
Eco130I	CCWWGG	1 cut(s)	50
EcoRI	GAATTC	1 cut(s)	138
EcoT14I	CCWWGG	1 cut(s)	50
ErhI	CCWWGG	1 cut(s)	50
FaiI	YATR	4 cut(s)	33, 64, 88, 165
FblI	GTMKAC	1 cut(s)	87
FspBI	CTAG	1 cut(s)	27
HaeIII	GGCC	2 cut(s)	208, 218
HinfI	GANTC	2 cut(s)	23, 180
Hpy166II	GTNNAC	1 cut(s)	88
Hpy8I	GTNNAC	1 cut(s)	88
HpyAV	CCTTC	1 cut(s)	257
HpyCH4III	ACNGT	1 cut(s)	85
HpyCH4V	TGCA	1 cut(s)	226
HpyF3I	CTNAG	1 cut(s)	249
Kzo9I	GATC	1 cut(s)	15
LpnPI	CCDG	2 cut(s)	232, 246
MaeI	CTAG	1 cut(s)	27
MalI	GATC	1 cut(s)	17
MboI	GATC	1 cut(s)	15
MfeI	CAATTG	1 cut(s)	39
MhlI	GDGCHC	1 cut(s)	202
MlsI	TGGCCA	1 cut(s)	218
MluCI	AATT	3 cut(s)	39, 67, 138
MluNI	TGGCCA	1 cut(s)	218
MnlI	CCTC	3 cut(s)	127, 152, 168
Mox20I	TGGCCA	1 cut(s)	218
MscI	TGGCCA	1 cut(s)	218
MseI	TTAA	1 cut(s)	212
Msp20I	TGGCCA	1 cut(s)	218
MunI	CAATTG	1 cut(s)	39
NdeII	GATC	1 cut(s)	15
NspV	TTCGAA	1 cut(s)	183
PfeI	GAWTC	2 cut(s)	23, 180
PspPI	GGNCC	1 cut(s)	207
SaqAI	TTAA	1 cut(s)	212
Sau3AI	GATC	1 cut(s)	15
Sau96I	GGNCC	1 cut(s)	207
SduI	GDGCHC	1 cut(s)	202
SetI	ASST	1 cut(s)	124
SfuI	TTCGAA	1 cut(s)	183
SgeI	CNNG	8 cut(s)	39, 63, 87, 207, 216, 231, 245, 249
Sse9I	AATT	3 cut(s)	39, 67, 138
SspI	AATATT	1 cut(s)	114
SspMI	CTAG	1 cut(s)	27
StyI	CCWWGG	1 cut(s)	50
TaaI	ACNGT	1 cut(s)	85
TaqI	TCGA	2 cut(s)	18, 183
TasI	AATT	3 cut(s)	39, 67, 138
TfiI	GAWTC	2 cut(s)	23, 180
Tru1I	TTAA	1 cut(s)	212
Tru9I	TTAA	1 cut(s)	212
TspDTI	ATGAA	2 cut(s)	36, 276
TspGWI	ACGGA	1 cut(s)	94
XapI	RAATTY	2 cut(s)	67, 138
XmiI	GTMKAC	1 cut(s)	87
XspI	CTAG	1 cut(s)	27

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.