pycom10g21570

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
24144231 .. 24146184
1954 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 336 bp
ATGGGTCAAGAAGAAGAACAGCAACAGCTGCAGCAGCGACAAGGAGAAGAAGCTCCTCCACCTTCTTCTCAGGCGACCTCTCAGGAACCCTCCACCCAAACCGCCCCTCCTCCTCCCCCGTTCGATCCCAGTCGAATGATTGGCATCATCAAAAGAAAGGCCATGATAAAAGAGTTAGCTGCTGCATACCACGCAGAGTGCCTTGCATACTGTCAAGAGATTTTGGAACTTCAAAGGAAATCGGATGAGCCATTTATTGACCTGAAACCTCCAGAGGATATGAAGAAGCAGATAATGCGGCCCCCCAAGCGTCTAAAGAAACCCACTAGACGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.72

Weight (kDa)

8.6

Isoelectric Point (pI)

96.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012523)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 102, 298
AclWI GGATC 1 cut(s) 119
AgsI TTSAA 1 cut(s) 233
AluBI AGCT 3 cut(s) 28, 53, 179
AluI AGCT 3 cut(s) 28, 53, 179
AlwI GGATC 1 cut(s) 119
AoxI GGCC 2 cut(s) 159, 299
ApeKI GCWGC 5 cut(s) 28, 31, 34, 179, 182
AspS9I GGNCC 1 cut(s) 300
BbvI GCAGC 5 cut(s) 15, 43, 46, 166, 169
BfaI CTAG 1 cut(s) 327
BfmI CTRYAG 1 cut(s) 29
BisI GCNGC 6 cut(s) 29, 32, 35, 180, 183, 299
BlsI GCNGC 6 cut(s) 30, 33, 36, 181, 184, 300
BmgT120I GGNCC 1 cut(s) 300
BmiI GGNNCC 2 cut(s) 87, 302
BmrI ACTGGG 1 cut(s) 123
BmsI GCATC 1 cut(s) 153
BmuI ACTGGG 1 cut(s) 123
BpmI CTGGAG 1 cut(s) 255
BsaBI GATNNNNATC 1 cut(s) 143
BsaXI ACNNNNNCTCC 2 cut(s) 91, 121
Bse1I ACTGG 1 cut(s) 129
Bse8I GATNNNNATC 1 cut(s) 143
BseGI GGATG 1 cut(s) 250
BseJI GATNNNNATC 1 cut(s) 143
BseMII CTCAG 2 cut(s) 83, 95
BseNI ACTGG 1 cut(s) 129
BseRI GAGGAG 3 cut(s) 45, 99, 102
BseXI GCAGC 5 cut(s) 15, 43, 46, 166, 169
BshFI GGCC 2 cut(s) 161, 301
BsnI GGCC 2 cut(s) 161, 301
Bsp143I GATC 1 cut(s) 124
BspACI CCGC 2 cut(s) 102, 298
BspANI GGCC 2 cut(s) 161, 301
BspCNI CTCAG 2 cut(s) 82, 94
BspLI GGNNCC 2 cut(s) 87, 302
BspMAI CTGCAG 1 cut(s) 33
BspPI GGATC 1 cut(s) 119
BsrI ACTGG 1 cut(s) 129
BssMI GATC 1 cut(s) 124
Bst4CI ACNGT 1 cut(s) 212
BstAPI GCANNNNNTGC 2 cut(s) 28, 295
BstDEI CTNAG 2 cut(s) 69, 81
BstF5I GGATG 1 cut(s) 250
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BstMWI GCNNNNNNNGC 5 cut(s) 28, 34, 191, 295, 307
BstSFI CTRYAG 1 cut(s) 29
BstV1I GCAGC 5 cut(s) 15, 43, 46, 166, 169
BsuRI GGCC 2 cut(s) 161, 301
BtsCI GGATG 1 cut(s) 250
Cfr13I GGNCC 1 cut(s) 300
CseI GACGC 1 cut(s) 299
CviAII CATG 1 cut(s) 163
CviJI RGCY 6 cut(s) 28, 53, 161, 179, 250, 301
CviKI_1 RGCY 6 cut(s) 28, 53, 161, 179, 250, 301
DdeI CTNAG 2 cut(s) 69, 81
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
FaeI CATG 1 cut(s) 166
FaiI YATR 4 cut(s) 164, 187, 208, 281
FatI CATG 1 cut(s) 162
Fnu4HI GCNGC 6 cut(s) 29, 32, 35, 180, 183, 299
FokI GGATG 1 cut(s) 257
Fsp4HI GCNGC 6 cut(s) 29, 32, 35, 180, 183, 299
FspBI CTAG 1 cut(s) 327
GluI GCNGC 6 cut(s) 29, 32, 35, 180, 183, 299
GsuI CTGGAG 1 cut(s) 255
HaeIII GGCC 2 cut(s) 161, 301
HgaI GACGC 1 cut(s) 299
Hin1II CATG 1 cut(s) 166
Hpy188I TCNGA 1 cut(s) 244
Hpy188III TCNNGA 4 cut(s) 8, 83, 215, 272
HpyAV CCTTC 1 cut(s) 72
HpyCH4III ACNGT 1 cut(s) 212
HpyCH4V TGCA 3 cut(s) 31, 185, 206
HpyF10VI GCNNNNNNNGC 5 cut(s) 28, 34, 191, 295, 307
HpyF3I CTNAG 2 cut(s) 69, 81
Hsp92II CATG 1 cut(s) 166
Kzo9I GATC 1 cut(s) 124
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 5 cut(s) 56, 68, 142, 275, 285
Lsp1109I GCAGC 5 cut(s) 15, 43, 46, 166, 169
LweI GCATC 1 cut(s) 153
MaeI CTAG 1 cut(s) 327
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MboII GAAGA 5 cut(s) 23, 26, 57, 59, 295
MnlI CCTC 8 cut(s) 66, 88, 100, 117, 120, 123, 268, 279
MspA1I CMGCKG 1 cut(s) 28
MwoI GCNNNNNNNGC 5 cut(s) 28, 34, 191, 295, 307
NdeII GATC 1 cut(s) 124
NlaIII CATG 1 cut(s) 166
NlaIV GGNNCC 2 cut(s) 87, 302
PkrI GCNGC 6 cut(s) 30, 33, 36, 181, 184, 300
PspN4I GGNNCC 2 cut(s) 87, 302
PspPI GGNCC 1 cut(s) 300
PstI CTGCAG 1 cut(s) 33
PvuII CAGCTG 1 cut(s) 28
SatI GCNGC 6 cut(s) 29, 32, 35, 180, 183, 299
Sau3AI GATC 1 cut(s) 124
Sau96I GGNCC 1 cut(s) 300
SetI ASST 7 cut(s) 30, 55, 64, 80, 181, 264, 271
SfaNI GCATC 1 cut(s) 153
SfcI CTRYAG 1 cut(s) 29
SsiI CCGC 2 cut(s) 102, 298
SspMI CTAG 1 cut(s) 327
TaaI ACNGT 1 cut(s) 212
TaqI TCGA 2 cut(s) 123, 133
TauI GCSGC 1 cut(s) 301
TseI GCWGC 5 cut(s) 28, 31, 34, 179, 182
TspDTI ATGAA 1 cut(s) 296
XspI CTAG 1 cut(s) 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.