pycom11g06450

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Reverse (-)
4907315 .. 4907515
201 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGCTTGATATGTATGTGAAATGTGGGAGCATTGAGGAAGCGAAAGGATTGTTTGATAGGATGCCGGAGAAGGATATTTTCTCATGGACTGCAATGCTTGATGGGTATGCTCAGTCAGGAAATTATGATGAGGCTTGTTGGGTTTTCGCTGCAATGCCTGGTCAAGACATTGCTGCATGGAATGTCCTCATTTCGTCTTAA

Protein Analysis

67

Amino Acids

7.39

Weight (kDa)

4.07

Isoelectric Point (pI)

65.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR PF01535 27 - 54 2.2e-07 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021276)

Species Orthologous Gene IDs
pyrus_communis pycom11g06450
rosa_chinensis RchiOBHm_Chr4g0389951
rosa_roxburghii Rroxscaffold_1G00046390 Rroxscaffold_7G00187080
rosa_samantha Rh1CG250000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 157
ApeKI GCWGC 2 cut(s) 149, 173
BbvI GCAGC 2 cut(s) 136, 160
BccI CCATC 1 cut(s) 95
BciT130I CCWGG 1 cut(s) 159
BisI GCNGC 2 cut(s) 150, 174
BlsI GCNGC 2 cut(s) 151, 175
Bme1390I CCNGG 1 cut(s) 159
BmrFI CCNGG 1 cut(s) 159
BmsI GCATC 1 cut(s) 51
Bse3DI GCAATG 3 cut(s) 99, 159, 168
BseBI CCWGG 1 cut(s) 159
BseGI GGATG 1 cut(s) 66
BseMI GCAATG 3 cut(s) 99, 159, 168
BseMII CTCAG 1 cut(s) 125
BseXI GCAGC 2 cut(s) 136, 160
BsiSI CCGG 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 124
BsrDI GCAATG 3 cut(s) 99, 159, 168
Bst2UI CCWGG 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 66
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BstV1I GCAGC 2 cut(s) 136, 160
BtsCI GGATG 1 cut(s) 66
CviAII CATG 2 cut(s) 84, 177
CviJI RGCY 1 cut(s) 134
CviKI_1 RGCY 1 cut(s) 134
DdeI CTNAG 1 cut(s) 111
EcoRII CCWGG 1 cut(s) 157
FaeI CATG 2 cut(s) 87, 180
FaiI YATR 6 cut(s) 11, 15, 85, 108, 126, 178
FatI CATG 2 cut(s) 83, 176
Fnu4HI GCNGC 2 cut(s) 150, 174
FokI GGATG 1 cut(s) 73
Fsp4HI GCNGC 2 cut(s) 150, 174
GluI GCNGC 2 cut(s) 150, 174
HapII CCGG 1 cut(s) 65
Hin1II CATG 2 cut(s) 87, 180
HpaII CCGG 1 cut(s) 65
Hpy188III TCNNGA 2 cut(s) 117, 164
HpyAV CCTTC 1 cut(s) 64
HpyCH4V TGCA 3 cut(s) 92, 152, 176
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 2 cut(s) 87, 180
LmnI GCTCC 1 cut(s) 27
LpnPI CCDG 4 cut(s) 78, 102, 144, 171
Lsp1109I GCAGC 2 cut(s) 136, 160
LweI GCATC 1 cut(s) 51
MluCI AATT 1 cut(s) 121
MnlI CCTC 3 cut(s) 28, 124, 197
MseI TTAA 1 cut(s) 199
MspI CCGG 1 cut(s) 65
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
NlaIII CATG 2 cut(s) 87, 180
PkrI GCNGC 2 cut(s) 151, 175
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
SaqAI TTAA 1 cut(s) 199
SatI GCNGC 2 cut(s) 150, 174
ScrFI CCNGG 1 cut(s) 159
SfaNI GCATC 1 cut(s) 51
Sse9I AATT 1 cut(s) 121
StyD4I CCNGG 1 cut(s) 157
TasI AATT 1 cut(s) 121
Tru1I TTAA 1 cut(s) 199
Tru9I TTAA 1 cut(s) 199
TseI GCWGC 2 cut(s) 149, 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.