pycom12397g00280

Respiratory-chain NADH dehydrogenase, 30 Kd subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012397
OG0014621
Physical Location & Seq
Forward (+)
132330 .. 132806
477 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 477 bp
ATGCAGGGTCGTTTGTCTGCTTGGTTAGTCAAACATGGGTTAGTTCATAGATCTTTGGGCTTCGATTACCAAGGAATAGAAACTTTACAAATAAAACCCGAGGATTGGCATTCGATTGCTGTCATTTTATATGTATATGGTTACAATTATCTACGTTCCCAATGTGCTTATGATGTAGCACCAGGCGGACTGTTAGCTAGTGTCTATCATCTTACGAGAATAGAGTATGGTATAGATCAACCGGAAGAGGTATGCATAAAAGTATTTGCCTCAAGGAGGAATCCTAGAATTCCGTCTGTTTTCTGGGTTTGGAAAAGTGCGGATTTTCAAGAAAGGGAATCCTATGATATGCTGGGAATCCTTTATGATAATCATCCACGCCTGAAACGTATCTTAATGCCTGAAAGTTGGATAGGATGGCCTTTACGTAAGGATTATATTGCCCCTAATTTTTATGAAATACAAGATGCTCATTGA

Protein Analysis

159

Amino Acids

18.61

Weight (kDa)

6.58

Isoelectric Point (pI)

56.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Complex1_30kDa PF00329 30 - 148 5.7e-35 Respiratory-chain NADH dehydrogenase, 30 Kd subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 186, 320
AcsI RAATTY 1 cut(s) 288
AfiI CCNNNNNNNGG 2 cut(s) 105, 276
AgsI TTSAA 1 cut(s) 329
AjnI CCWGG 1 cut(s) 181
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
Ama87I CYCGRG 1 cut(s) 98
AoxI GGCC 1 cut(s) 419
ApoI RAATTY 1 cut(s) 288
AvaI CYCGRG 1 cut(s) 98
BccI CCATC 1 cut(s) 411
BciT130I CCWGG 1 cut(s) 183
BfaI CTAG 2 cut(s) 198, 285
BglII AGATCT 1 cut(s) 50
Bme1390I CCNGG 1 cut(s) 183
BmeT110I CYCGRG 1 cut(s) 98
BmrFI CCNGG 1 cut(s) 183
BmsI GCATC 1 cut(s) 457
BpuEI CTTGAG 1 cut(s) 256
BsaAI YACGTR 1 cut(s) 428
BsaBI GATNNNNATC 1 cut(s) 372
BsaJI CCNNGG 2 cut(s) 70, 99
BsaWI WCCGGW 1 cut(s) 241
Bsc4I CCNNNNNNNGG 2 cut(s) 105, 276
Bse8I GATNNNNATC 1 cut(s) 372
BseBI CCWGG 1 cut(s) 183
BseDI CCNNGG 2 cut(s) 70, 99
BseGI GGATG 2 cut(s) 373, 422
BseJI GATNNNNATC 1 cut(s) 372
BseLI CCNNNNNNNGG 2 cut(s) 105, 276
BseYI CCCAGC 1 cut(s) 352
BshFI GGCC 1 cut(s) 421
BsiHKCI CYCGRG 1 cut(s) 98
BsiSI CCGG 1 cut(s) 242
BslI CCNNNNNNNGG 2 cut(s) 105, 276
BsmI GAATGC 1 cut(s) 109
BsnI GGCC 1 cut(s) 421
BsoBI CYCGRG 1 cut(s) 98
Bsp143I GATC 2 cut(s) 50, 235
BspACI CCGC 2 cut(s) 186, 320
BspANI GGCC 1 cut(s) 421
BssECI CCNNGG 2 cut(s) 70, 99
BssMI GATC 2 cut(s) 50, 235
BssT1I CCWWGG 1 cut(s) 70
Bst2UI CCWGG 1 cut(s) 183
Bst4CI ACNGT 1 cut(s) 192
Bst6I CTCTTC 1 cut(s) 240
BstBAI YACGTR 1 cut(s) 428
BstENI CCTNNNNNAGG 1 cut(s) 274
BstF5I GGATG 2 cut(s) 373, 422
BstKTI GATC 2 cut(s) 53, 238
BstMBI GATC 2 cut(s) 50, 235
BstNI CCWGG 1 cut(s) 183
BstSCI CCNGG 1 cut(s) 181
BstSNI TACGTA 1 cut(s) 428
BstX2I RGATCY 1 cut(s) 50
BstYI RGATCY 1 cut(s) 50
BsuRI GGCC 1 cut(s) 421
BtsCI GGATG 2 cut(s) 373, 422
CviAII CATG 1 cut(s) 35
CviJI RGCY 3 cut(s) 60, 197, 421
CviKI_1 RGCY 3 cut(s) 60, 197, 421
DpnI GATC 2 cut(s) 52, 237
DpnII GATC 2 cut(s) 50, 235
Eam1104I CTCTTC 1 cut(s) 240
EarI CTCTTC 1 cut(s) 240
EciI GGCGGA 1 cut(s) 201
Eco105I TACGTA 1 cut(s) 428
Eco130I CCWWGG 1 cut(s) 70
Eco88I CYCGRG 1 cut(s) 98
EcoNI CCTNNNNNAGG 1 cut(s) 274
EcoRI GAATTC 1 cut(s) 288
EcoRII CCWGG 1 cut(s) 181
EcoT14I CCWWGG 1 cut(s) 70
EcoT22I ATGCAT 1 cut(s) 257
ErhI CCWWGG 1 cut(s) 70
FaeI CATG 1 cut(s) 38
FatI CATG 1 cut(s) 34
FokI GGATG 2 cut(s) 360, 429
FspBI CTAG 2 cut(s) 198, 285
GsaI CCCAGC 1 cut(s) 356
HaeIII GGCC 1 cut(s) 421
HapII CCGG 1 cut(s) 242
Hin1II CATG 1 cut(s) 38
HinfI GANTC 3 cut(s) 280, 338, 357
HpaII CCGG 1 cut(s) 242
Hpy188III TCNNGA 1 cut(s) 329
HpyCH4III ACNGT 1 cut(s) 192
HpyCH4IV ACGT 3 cut(s) 154, 388, 427
HpyCH4V TGCA 2 cut(s) 4, 255
HpySE526I ACGT 3 cut(s) 154, 388, 427
Hsp92II CATG 1 cut(s) 38
Kzo9I GATC 2 cut(s) 50, 235
LpnPI CCDG 7 cut(s) 168, 195, 255, 289, 338, 395, 414
LweI GCATC 1 cut(s) 457
MaeI CTAG 2 cut(s) 198, 285
MaeII ACGT 3 cut(s) 154, 388, 427
MaeIII GTNAC 1 cut(s) 140
MalI GATC 2 cut(s) 52, 237
MboI GATC 2 cut(s) 50, 235
MboII GAAGA 1 cut(s) 257
MflI RGATCY 1 cut(s) 50
MluCI AATT 3 cut(s) 145, 288, 448
MmeI TCCRAC 1 cut(s) 389
MnlI CCTC 4 cut(s) 94, 241, 270, 280
Mph1103I ATGCAT 1 cut(s) 257
MseI TTAA 1 cut(s) 395
MspI CCGG 1 cut(s) 242
MspR9I CCNGG 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 109
MvaI CCWGG 1 cut(s) 183
NdeII GATC 2 cut(s) 50, 235
NlaIII CATG 1 cut(s) 38
NsiI ATGCAT 1 cut(s) 257
PcsI WCGNNNNNNNCGW 1 cut(s) 385
PctI GAATGC 1 cut(s) 109
PfeI GAWTC 3 cut(s) 280, 338, 357
Ppu21I YACGTR 1 cut(s) 428
Psp6I CCWGG 1 cut(s) 181
PspFI CCCAGC 1 cut(s) 352
PspGI CCWGG 1 cut(s) 181
PsuI RGATCY 1 cut(s) 50
SaqAI TTAA 1 cut(s) 395
Sau3AI GATC 2 cut(s) 50, 235
ScrFI CCNGG 1 cut(s) 183
SetI ASST 5 cut(s) 157, 199, 252, 391, 430
SfaNI GCATC 1 cut(s) 457
SmlI CTYRAG 1 cut(s) 271
SmoI CTYRAG 1 cut(s) 271
SnaBI TACGTA 1 cut(s) 428
Sse9I AATT 3 cut(s) 145, 288, 448
SsiI CCGC 2 cut(s) 186, 320
SspMI CTAG 2 cut(s) 198, 285
StyD4I CCNGG 1 cut(s) 181
StyI CCWWGG 1 cut(s) 70
TaaI ACNGT 1 cut(s) 192
TaiI ACGT 3 cut(s) 157, 391, 430
TaqI TCGA 2 cut(s) 63, 113
TasI AATT 3 cut(s) 145, 288, 448
TfiI GAWTC 3 cut(s) 280, 338, 357
Tru1I TTAA 1 cut(s) 395
Tru9I TTAA 1 cut(s) 395
TspDTI ATGAA 2 cut(s) 35, 471
TspGWI ACGGA 1 cut(s) 282
XagI CCTNNNNNAGG 1 cut(s) 274
XapI RAATTY 1 cut(s) 288
XspI CTAG 2 cut(s) 198, 285
Zsp2I ATGCAT 1 cut(s) 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.