pycom14g05980

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
5798057 .. 5798438
382 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 255 bp
ATGCATTATGTTAGAATCTGTAGGGAGAAAGCAACTTGTCACGTATATGCAATGAAGAAGCTTAAGAAATTAGTGGAACATATGAAAGTTGAGAGGAATCTACTTGTTGAGGTTGATAGTAATTGTATTGTCAAGCTTTATTGTTCGTTCCAGAATGAAGAGTACTTGTATCTAATTATGGAATATCTTCCTAGTTGGGATATGATGACTTTATTGATGTGCAAGGACACATTGACAAAAGATGAAGCTTGTTGA

Protein Analysis

85

Amino Acids

10.12

Weight (kDa)

6.8

Isoelectric Point (pI)

33.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 4 - 82 4.4e-09 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021139)

Species Orthologous Gene IDs
malus_domestica MD15G1269700.v1.1 MD16G1194900.v1.1
pyrus_communis pycom14g05980 pycom17g09670
rosa_multiflora Rmu_co8294415.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 164
AflII CTTAAG 1 cut(s) 62
AluBI AGCT 3 cut(s) 61, 136, 248
AluI AGCT 3 cut(s) 61, 136, 248
Asp700I GAANNNNTTC 1 cut(s) 186
BfaI CTAG 1 cut(s) 192
BfmI CTRYAG 1 cut(s) 19
BfrI CTTAAG 1 cut(s) 62
BmcAI AGTACT 1 cut(s) 164
BsaAI YACGTR 1 cut(s) 43
Bse3DI GCAATG 1 cut(s) 57
BseMI GCAATG 1 cut(s) 57
BspTI CTTAAG 1 cut(s) 62
BsrDI GCAATG 1 cut(s) 57
Bst6I CTCTTC 1 cut(s) 153
BstAFI CTTAAG 1 cut(s) 62
BstBAI YACGTR 1 cut(s) 43
BstSFI CTRYAG 1 cut(s) 19
Csp6I GTAC 1 cut(s) 163
CviJI RGCY 3 cut(s) 61, 136, 248
CviKI_1 RGCY 3 cut(s) 61, 136, 248
CviQI GTAC 1 cut(s) 163
Eam1104I CTCTTC 1 cut(s) 153
EarI CTCTTC 1 cut(s) 153
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 7 cut(s) 9, 46, 48, 81, 83, 179, 203
FauNDI CATATG 1 cut(s) 81
FspBI CTAG 1 cut(s) 192
HindIII AAGCTT 3 cut(s) 59, 134, 246
HinfI GANTC 2 cut(s) 15, 97
Hpy188III TCNNGA 1 cut(s) 151
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 3 cut(s) 4, 50, 222
HpySE526I ACGT 1 cut(s) 42
LpnPI CCDG 1 cut(s) 164
MaeI CTAG 1 cut(s) 192
MaeII ACGT 1 cut(s) 42
MaeIII GTNAC 1 cut(s) 38
MboII GAAGA 3 cut(s) 67, 170, 179
MluCI AATT 3 cut(s) 68, 121, 174
MnlI CCTC 2 cut(s) 87, 103
Mph1103I ATGCAT 1 cut(s) 6
MroXI GAANNNNTTC 1 cut(s) 186
MseI TTAA 1 cut(s) 63
MslI CAYNNNNRTG 1 cut(s) 45
MspCI CTTAAG 1 cut(s) 62
NdeI CATATG 1 cut(s) 81
NmuCI GTSAC 1 cut(s) 38
NsiI ATGCAT 1 cut(s) 6
PdmI GAANNNNTTC 1 cut(s) 186
PfeI GAWTC 2 cut(s) 15, 97
Ppu21I YACGTR 1 cut(s) 43
RsaI GTAC 1 cut(s) 164
RsaNI GTAC 1 cut(s) 163
RseI CAYNNNNRTG 1 cut(s) 45
SaqAI TTAA 1 cut(s) 63
ScaI AGTACT 1 cut(s) 164
SetI ASST 5 cut(s) 45, 63, 114, 138, 250
SfcI CTRYAG 1 cut(s) 19
SgeI CNNG 8 cut(s) 48, 53, 116, 145, 163, 178, 204, 235
SmiMI CAYNNNNRTG 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 62
SmoI CTYRAG 1 cut(s) 62
Sse9I AATT 3 cut(s) 68, 121, 174
SspMI CTAG 1 cut(s) 192
TaiI ACGT 1 cut(s) 45
TasI AATT 3 cut(s) 68, 121, 174
TatI WGTACW 1 cut(s) 162
TfiI GAWTC 2 cut(s) 15, 97
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TseFI GTSAC 1 cut(s) 38
Tsp45I GTSAC 1 cut(s) 38
TspDTI ATGAA 3 cut(s) 68, 98, 171
Vha464I CTTAAG 1 cut(s) 62
XmnI GAANNNNTTC 1 cut(s) 186
XspI CTAG 1 cut(s) 192
ZrmI AGTACT 1 cut(s) 164
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.