pycom15g12130

Introduces a single-strand break via transesterification at a target site in duplex DNA. Releases the supercoiling and torsional tension of DNA introduced during the DNA replication and transcription by transiently cleaving and rejoining one strand of the DNA duplex. The scissile phosphodiester is attacked by the catalytic tyrosine of the enzyme, resulting in the formation of a DNA-(5'-phosphotyrosyl)-enzyme intermediate and the expulsion of a 3'-OH DNA strand

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
8263130 .. 8271495
8366 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g12130.4

Sequence Viewer

Length: 777 bp
ATGTTTTTTATATTTTTTAGAAAAAATTACTTAGACGTTTATCGATTTGAATCATGGGGAGGTTCGTTGCTACCAACATATGAATTTGGACAACAGTTTGTCCCAACAACATTAACTCTTGATTCAGGAGTCACTAGGCCTCCACCACTTTTAAGTGAAGCTGATTTGCTGAGCTGTATGGACAAGGAGGGCATTGGCACAGATGCAACGATGCATGATCACATAAAAAAGCTGCTGGATCGATTTTATGCAACCAAGGACTCAAGCATGCGTTTCTCACCGACCAATCTTGGCGAAGCGTTGGTGATGGGATATGATGACATGGGGTATAAACTGTGGAAACCATACCTTAGAGCTGTTATGGAGCGTGACATGAAAGCTGTTAGTGAAGGTGCTAAGAGCAAAGCTGAAGTTTTGGAAACTTGCTTGCAGCAAATGAAAGCTTGCTTCCTAGATGCAAGGTTGAACAAAGTAAAACTCTTTGAAGCCATGTCAGTATTCTTTGAGAGATCTAGCAGGCCTAGTGGGGATGATCAGCACACATCTGGAGAGTTCGTTCGGCAATGTGGGCTGTGCCACGAAGCAGATATGGTACTTAGACAAAACCGGGATGGAAATTTCATGGTTGGATGCTTGGGTTATCCTCAGGTTGGTCCTTGTCTAAGATATACTTATTCTAGTCTAAATTGCTTGTTTGTAAGAAGTTTTATCTGCATTACTTTTAACAATTTGTTAACAAGGAAGAAAATCTATTGGTTGTATCTAATATTGTTCTGA

Protein Analysis

259

Amino Acids

29.73

Weight (kDa)

8.02

Isoelectric Point (pI)

42.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022562)

Species Orthologous Gene IDs
pyrus_communis pycom15g12130
rosa_rugosa Rorug04G0002900
rosa_samantha Rh4BG116600 Rh5CG489700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 246
AcsI RAATTY 2 cut(s) 83, 616
AcuI CTGAAG 1 cut(s) 429
AfaI GTAC 1 cut(s) 594
AfiI CCNNNNNNNGG 1 cut(s) 650
AgsI TTSAA 3 cut(s) 50, 466, 485
AloI GAACNNNNNNTCC 2 cut(s) 540, 572
AluBI AGCT 7 cut(s) 161, 174, 232, 356, 380, 407, 443
AluI AGCT 7 cut(s) 161, 174, 232, 356, 380, 407, 443
AlwI GGATC 1 cut(s) 246
AoxI GGCC 2 cut(s) 137, 518
ApeKI GCWGC 2 cut(s) 232, 430
ApoI RAATTY 2 cut(s) 83, 616
AspS9I GGNCC 1 cut(s) 653
AsuC2I CCSGG 1 cut(s) 608
AsuHPI GGTGA 2 cut(s) 270, 316
AvaII GGWCC 1 cut(s) 653
AxyI CCTNAGG 1 cut(s) 645
BbvI GCAGC 2 cut(s) 219, 442
BccI CCATC 2 cut(s) 301, 605
BclI TGATCA 2 cut(s) 217, 532
BcnI CCSGG 1 cut(s) 608
BfaI CTAG 5 cut(s) 135, 452, 513, 522, 678
BglII AGATCT 1 cut(s) 509
BisI GCNGC 2 cut(s) 233, 431
BlpI GCTNAGC 1 cut(s) 170
BlsI GCNGC 2 cut(s) 234, 432
Bme1390I CCNGG 1 cut(s) 608
Bme18I GGWCC 1 cut(s) 653
BmgT120I GGNCC 1 cut(s) 653
BmrFI CCNGG 1 cut(s) 608
BmsI GCATC 4 cut(s) 193, 201, 445, 620
BpmI CTGGAG 1 cut(s) 567
Bpu1102I GCTNAGC 1 cut(s) 170
BpuEI CTTGAG 1 cut(s) 247
BpuMI CCSGG 1 cut(s) 608
Bsa29I ATCGAT 2 cut(s) 43, 241
BsaBI GATNNNNATC 1 cut(s) 49
BsaJI CCNNGG 1 cut(s) 255
BsaXI ACNNNNNCTCC 4 cut(s) 124, 154, 540, 570
Bsc4I CCNNNNNNNGG 1 cut(s) 650
Bse21I CCTNAGG 1 cut(s) 645
Bse3DI GCAATG 1 cut(s) 569
Bse8I GATNNNNATC 1 cut(s) 49
BseCI ATCGAT 2 cut(s) 43, 241
BseDI CCNNGG 1 cut(s) 255
BseGI GGATG 3 cut(s) 535, 616, 635
BseJI GATNNNNATC 1 cut(s) 49
BseLI CCNNNNNNNGG 1 cut(s) 650
BseMI GCAATG 1 cut(s) 569
BseMII CTCAG 2 cut(s) 161, 659
BseXI GCAGC 2 cut(s) 219, 442
BshFI GGCC 2 cut(s) 139, 520
BshVI ATCGAT 2 cut(s) 43, 241
BsiSI CCGG 1 cut(s) 607
BslFI GGGAC 1 cut(s) 86
BslI CCNNNNNNNGG 1 cut(s) 650
BsmFI GGGAC 1 cut(s) 86
BsnI GGCC 2 cut(s) 139, 520
Bsp143I GATC 4 cut(s) 217, 238, 509, 532
Bsp1720I GCTNAGC 1 cut(s) 170
BspANI GGCC 2 cut(s) 139, 520
BspCNI CTCAG 2 cut(s) 162, 658
BspDI ATCGAT 2 cut(s) 43, 241
BspPI GGATC 1 cut(s) 246
BsrDI GCAATG 1 cut(s) 569
BssECI CCNNGG 1 cut(s) 255
BssMI GATC 4 cut(s) 217, 238, 509, 532
BssT1I CCWWGG 1 cut(s) 255
Bst4CI ACNGT 2 cut(s) 96, 336
BstC8I GCNNGC 4 cut(s) 269, 428, 445, 518
BstDEI CTNAG 7 cut(s) 31, 170, 350, 396, 596, 645, 662
BstF5I GGATG 3 cut(s) 535, 616, 635
BstKTI GATC 4 cut(s) 220, 241, 512, 535
BstMBI GATC 4 cut(s) 217, 238, 509, 532
BstMWI GCNNNNNNNGC 1 cut(s) 568
BstNSI RCATGY 1 cut(s) 271
BstSCI CCNGG 1 cut(s) 606
BstV1I GCAGC 2 cut(s) 219, 442
BstX2I RGATCY 1 cut(s) 509
BstYI RGATCY 1 cut(s) 509
Bsu15I ATCGAT 2 cut(s) 43, 241
Bsu36I CCTNAGG 1 cut(s) 645
BsuRI GGCC 2 cut(s) 139, 520
BsuTUI ATCGAT 2 cut(s) 43, 241
BtsCI GGATG 3 cut(s) 535, 616, 635
Cac8I GCNNGC 4 cut(s) 269, 428, 445, 518
Cfr13I GGNCC 1 cut(s) 653
ClaI ATCGAT 2 cut(s) 43, 241
Csp6I GTAC 1 cut(s) 593
CviAII CATG 7 cut(s) 54, 215, 268, 322, 373, 490, 622
CviQI GTAC 1 cut(s) 593
DdeI CTNAG 7 cut(s) 31, 170, 350, 396, 596, 645, 662
DpnI GATC 4 cut(s) 219, 240, 511, 534
DpnII GATC 4 cut(s) 217, 238, 509, 532
Eco130I CCWWGG 1 cut(s) 255
Eco147I AGGCCT 2 cut(s) 139, 520
Eco47I GGWCC 1 cut(s) 653
Eco57I CTGAAG 1 cut(s) 429
Eco81I CCTNAGG 1 cut(s) 645
EcoT14I CCWWGG 1 cut(s) 255
EcoT22I ATGCAT 1 cut(s) 216
ErhI CCWWGG 1 cut(s) 255
FaeI CATG 7 cut(s) 57, 218, 271, 325, 376, 493, 625
FalI AAGNNNNNCTT 2 cut(s) 655, 687
FaqI GGGAC 1 cut(s) 86
FatI CATG 7 cut(s) 53, 214, 267, 321, 372, 489, 621
FauNDI CATATG 1 cut(s) 79
FbaI TGATCA 2 cut(s) 217, 532
Fnu4HI GCNGC 2 cut(s) 233, 431
FokI GGATG 3 cut(s) 542, 623, 642
Fsp4HI GCNGC 2 cut(s) 233, 431
FspBI CTAG 5 cut(s) 135, 452, 513, 522, 678
GluI GCNGC 2 cut(s) 233, 431
GsuI CTGGAG 1 cut(s) 567
HaeIII GGCC 2 cut(s) 139, 520
HapII CCGG 1 cut(s) 607
Hin1II CATG 7 cut(s) 57, 218, 271, 325, 376, 493, 625
HincII GTYRAC 1 cut(s) 735
HindII GTYRAC 1 cut(s) 735
HindIII AAGCTT 1 cut(s) 441
HinfI GANTC 4 cut(s) 50, 122, 129, 260
HpaI GTTAAC 1 cut(s) 735
HpaII CCGG 1 cut(s) 607
HphI GGTGA 2 cut(s) 270, 316
Hpy166II GTNNAC 1 cut(s) 735
Hpy188I TCNGA 1 cut(s) 776
Hpy188III TCNNGA 3 cut(s) 119, 126, 546
Hpy8I GTNNAC 1 cut(s) 735
HpyAV CCTTC 1 cut(s) 383
HpyCH4III ACNGT 2 cut(s) 96, 336
HpyCH4IV ACGT 1 cut(s) 36
HpyCH4V TGCA 6 cut(s) 206, 214, 251, 430, 458, 714
HpyF10VI GCNNNNNNNGC 1 cut(s) 568
HpyF3I CTNAG 7 cut(s) 31, 170, 350, 396, 596, 645, 662
HpySE526I ACGT 1 cut(s) 36
Hsp92II CATG 7 cut(s) 57, 218, 271, 325, 376, 493, 625
Ksp22I TGATCA 2 cut(s) 217, 532
KspAI GTTAAC 1 cut(s) 735
Kzo9I GATC 4 cut(s) 217, 238, 509, 532
LmnI GCTCC 1 cut(s) 364
LpnPI CCDG 6 cut(s) 111, 221, 502, 531, 620, 632
Lsp1109I GCAGC 2 cut(s) 219, 442
LweI GCATC 4 cut(s) 193, 201, 445, 620
MaeI CTAG 5 cut(s) 135, 452, 513, 522, 678
MaeII ACGT 1 cut(s) 36
MaeIII GTNAC 2 cut(s) 130, 368
MalI GATC 4 cut(s) 219, 240, 511, 534
MboI GATC 4 cut(s) 217, 238, 509, 532
MboII GAAGA 1 cut(s) 754
MflI RGATCY 1 cut(s) 509
MluCI AATT 5 cut(s) 25, 83, 616, 685, 727
MlyI GAGTC 2 cut(s) 138, 254
MmeI TCCRAC 1 cut(s) 607
MnlI CCTC 4 cut(s) 53, 150, 181, 654
Mph1103I ATGCAT 1 cut(s) 216
MseI TTAA 4 cut(s) 113, 152, 723, 734
MspI CCGG 1 cut(s) 607
MspR9I CCNGG 1 cut(s) 608
MwoI GCNNNNNNNGC 1 cut(s) 568
NciI CCSGG 1 cut(s) 608
NdeI CATATG 1 cut(s) 79
NdeII GATC 4 cut(s) 217, 238, 509, 532
NlaIII CATG 7 cut(s) 57, 218, 271, 325, 376, 493, 625
NmuCI GTSAC 2 cut(s) 130, 368
NsiI ATGCAT 1 cut(s) 216
NspI RCATGY 1 cut(s) 271
PaeI GCATGC 1 cut(s) 271
PceI AGGCCT 2 cut(s) 139, 520
PfeI GAWTC 2 cut(s) 50, 122
PkrI GCNGC 2 cut(s) 234, 432
PleI GAGTC 2 cut(s) 137, 254
PpsI GAGTC 2 cut(s) 137, 254
PspPI GGNCC 1 cut(s) 653
PsuI RGATCY 1 cut(s) 509
RsaI GTAC 1 cut(s) 594
RsaNI GTAC 1 cut(s) 593
SaqAI TTAA 4 cut(s) 113, 152, 723, 734
SatI GCNGC 2 cut(s) 233, 431
Sau3AI GATC 4 cut(s) 217, 238, 509, 532
Sau96I GGNCC 1 cut(s) 653
SchI GAGTC 2 cut(s) 138, 254
ScrFI CCNGG 1 cut(s) 608
SfaNI GCATC 4 cut(s) 193, 201, 445, 620
SinI GGWCC 1 cut(s) 653
SmlI CTYRAG 1 cut(s) 262
SmoI CTYRAG 1 cut(s) 262
SphI GCATGC 1 cut(s) 271
Sse9I AATT 5 cut(s) 25, 83, 616, 685, 727
SseBI AGGCCT 2 cut(s) 139, 520
SspI AATATT 1 cut(s) 768
SspMI CTAG 5 cut(s) 135, 452, 513, 522, 678
StuI AGGCCT 2 cut(s) 139, 520
StyD4I CCNGG 1 cut(s) 606
StyI CCWWGG 1 cut(s) 255
TaaI ACNGT 2 cut(s) 96, 336
TaiI ACGT 1 cut(s) 39
TaqI TCGA 2 cut(s) 43, 241
TasI AATT 5 cut(s) 25, 83, 616, 685, 727
TfiI GAWTC 2 cut(s) 50, 122
Tru1I TTAA 4 cut(s) 113, 152, 723, 734
Tru9I TTAA 4 cut(s) 113, 152, 723, 734
TseFI GTSAC 2 cut(s) 130, 368
TseI GCWGC 2 cut(s) 232, 430
Tsp45I GTSAC 2 cut(s) 130, 368
TspDTI ATGAA 4 cut(s) 96, 389, 452, 610
VpaK11BI GGWCC 1 cut(s) 653
XapI RAATTY 2 cut(s) 83, 616
XceI RCATGY 1 cut(s) 271
XspI CTAG 5 cut(s) 135, 452, 513, 522, 678
Zsp2I ATGCAT 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.