Rh4BG116600

Introduces a single-strand break via transesterification at a target site in duplex DNA. Releases the supercoiling and torsional tension of DNA introduced during the DNA replication and transcription by transiently cleaving and rejoining one strand of the DNA duplex. The scissile phosphodiester is attacked by the catalytic tyrosine of the enzyme, resulting in the formation of a DNA-(5'-phosphotyrosyl)-enzyme intermediate and the expulsion of a 3'-OH DNA strand

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
19612688 .. 19614222
1535 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG116600.1

Sequence Viewer

Length: 225 bp
ATGAATAGGAGAGACTTTCGGTATAAACTCTGGAATCCCTACCTTAGAGCTGTTATGGAGTGTGACATGAAAGCAGTCAGCGAAGGTGAAGCTGAACAAAGAAACTTTTTGAAATCATGGGAGTGTTCTTTGAGAGTTCAAATAGACCTTGTGGAGATGACAGTATGCATCTGGAGAGTTCATTCGACGATGTGGACTCTGCCAGGAAGCGGATATGGTGCTTAG

Protein Analysis

74

Amino Acids

8.79

Weight (kDa)

7.72

Isoelectric Point (pI)

38.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022562)

Species Orthologous Gene IDs
pyrus_communis pycom15g12130
rosa_rugosa Rorug04G0002900
rosa_samantha Rh4BG116600 Rh5CG489700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 210
AfiI CCNNNNNNNGG 1 cut(s) 209
AgsI TTSAA 2 cut(s) 112, 140
AjnI CCWGG 1 cut(s) 202
AluBI AGCT 2 cut(s) 50, 92
AluI AGCT 2 cut(s) 50, 92
Alw26I GTCTC 1 cut(s) 6
AsuHPI GGTGA 1 cut(s) 98
BciT130I CCWGG 1 cut(s) 204
BcoDI GTCTC 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 204
BmrFI CCNGG 1 cut(s) 204
BmsI GCATC 1 cut(s) 177
BpmI CTGGAG 1 cut(s) 193
Bsc4I CCNNNNNNNGG 1 cut(s) 209
BseBI CCWGG 1 cut(s) 204
BseLI CCNNNNNNNGG 1 cut(s) 209
BslI CCNNNNNNNGG 1 cut(s) 209
BsmAI GTCTC 1 cut(s) 6
BspACI CCGC 1 cut(s) 210
Bst2UI CCWGG 1 cut(s) 204
Bst4CI ACNGT 1 cut(s) 163
BstDEI CTNAG 2 cut(s) 44, 222
BstMAI GTCTC 1 cut(s) 6
BstNI CCWGG 1 cut(s) 204
BstSCI CCNGG 1 cut(s) 202
CviAII CATG 2 cut(s) 67, 117
CviJI RGCY 2 cut(s) 50, 92
CviKI_1 RGCY 2 cut(s) 50, 92
DdeI CTNAG 2 cut(s) 44, 222
EcoRII CCWGG 1 cut(s) 202
EcoT22I ATGCAT 1 cut(s) 170
FaeI CATG 2 cut(s) 70, 120
FaiI YATR 6 cut(s) 24, 56, 68, 118, 166, 216
FatI CATG 2 cut(s) 66, 116
GsuI CTGGAG 1 cut(s) 193
Hin1II CATG 2 cut(s) 70, 120
HinfI GANTC 2 cut(s) 34, 196
HphI GGTGA 1 cut(s) 98
Hpy166II GTNNAC 1 cut(s) 195
Hpy188III TCNNGA 2 cut(s) 31, 172
Hpy8I GTNNAC 1 cut(s) 195
Hpy99I CGWCG 1 cut(s) 190
HpyAV CCTTC 1 cut(s) 77
HpyCH4III ACNGT 1 cut(s) 163
HpyCH4V TGCA 1 cut(s) 168
HpyF3I CTNAG 2 cut(s) 44, 222
Hsp92II CATG 2 cut(s) 70, 120
LpnPI CCDG 4 cut(s) 16, 157, 189, 216
LweI GCATC 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 62
MlyI GAGTC 1 cut(s) 190
Mph1103I ATGCAT 1 cut(s) 170
MslI CAYNNNNRTG 1 cut(s) 121
MspR9I CCNGG 1 cut(s) 204
MvaI CCWGG 1 cut(s) 204
NlaIII CATG 2 cut(s) 70, 120
NmuCI GTSAC 1 cut(s) 62
NsiI ATGCAT 1 cut(s) 170
PfeI GAWTC 1 cut(s) 34
PleI GAGTC 1 cut(s) 190
PpsI GAGTC 1 cut(s) 190
Psp6I CCWGG 1 cut(s) 202
PspGI CCWGG 1 cut(s) 202
RseI CAYNNNNRTG 1 cut(s) 121
SchI GAGTC 1 cut(s) 190
ScrFI CCNGG 1 cut(s) 204
SetI ASST 5 cut(s) 45, 52, 88, 94, 150
SfaNI GCATC 1 cut(s) 177
SgeI CNNG 7 cut(s) 43, 79, 129, 161, 184, 215, 216
SmiMI CAYNNNNRTG 1 cut(s) 121
SsiI CCGC 1 cut(s) 210
StyD4I CCNGG 1 cut(s) 202
TaaI ACNGT 1 cut(s) 163
TaqI TCGA 1 cut(s) 185
TfiI GAWTC 1 cut(s) 34
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 3 cut(s) 17, 83, 170
Zsp2I ATGCAT 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.