Rh5CG489700

Introduces a single-strand break via transesterification at a target site in duplex DNA. Releases the supercoiling and torsional tension of DNA introduced during the DNA replication and transcription by transiently cleaving and rejoining one strand of the DNA duplex. The scissile phosphodiester is attacked by the catalytic tyrosine of the enzyme, resulting in the formation of a DNA-(5'-phosphotyrosyl)-enzyme intermediate and the expulsion of a 3'-OH DNA strand

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
68296676 .. 68297744
1069 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG489700.1

Sequence Viewer

Length: 162 bp
ATGAGTACGCGAGGCTTAAAGTATAAACTCTGGAATCCCTACCTTAGAGCTGTTATGGAGTGTGACATGAAAGCAGTCAGCGAAGGTAATAAGAGCAAAGCTGAAGTTTTGGAAACTTGCTTGCAGCAAATGAAAGCCTGCTTCCTTGATATAATCTTGTAG

Protein Analysis

53

Amino Acids

6.1

Weight (kDa)

8.53

Isoelectric Point (pI)

66.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022562)

Species Orthologous Gene IDs
pyrus_communis pycom15g12130
rosa_rugosa Rorug04G0002900
rosa_samantha Rh4BG116600 Rh5CG489700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 10
AcuI CTGAAG 1 cut(s) 123
AfaI GTAC 1 cut(s) 7
AluBI AGCT 2 cut(s) 50, 101
AluI AGCT 2 cut(s) 50, 101
ApeKI GCWGC 1 cut(s) 124
BbvI GCAGC 1 cut(s) 136
BisI GCNGC 1 cut(s) 125
BlsI GCNGC 1 cut(s) 126
BseXI GCAGC 1 cut(s) 136
Bsh1236I CGCG 1 cut(s) 10
BspFNI CGCG 1 cut(s) 10
BstC8I GCNNGC 2 cut(s) 122, 139
BstDEI CTNAG 1 cut(s) 44
BstFNI CGCG 1 cut(s) 10
BstUI CGCG 1 cut(s) 10
BstV1I GCAGC 1 cut(s) 136
Cac8I GCNNGC 2 cut(s) 122, 139
Csp6I GTAC 1 cut(s) 6
CviAII CATG 1 cut(s) 67
CviJI RGCY 4 cut(s) 15, 50, 101, 137
CviKI_1 RGCY 4 cut(s) 15, 50, 101, 137
CviQI GTAC 1 cut(s) 6
DdeI CTNAG 1 cut(s) 44
Eco57I CTGAAG 1 cut(s) 123
FaeI CATG 1 cut(s) 70
FaiI YATR 4 cut(s) 24, 56, 68, 152
FatI CATG 1 cut(s) 66
Fnu4HI GCNGC 1 cut(s) 125
Fsp4HI GCNGC 1 cut(s) 125
FspEI CC 9 cut(s) 16, 41, 51, 52, 56, 69, 95, 151, 158
GluI GCNGC 1 cut(s) 125
Hin1II CATG 1 cut(s) 70
HinfI GANTC 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 77
HpyCH4V TGCA 1 cut(s) 124
HpyF3I CTNAG 1 cut(s) 44
Hsp92II CATG 1 cut(s) 70
LpnPI CCDG 2 cut(s) 16, 151
Lsp1109I GCAGC 1 cut(s) 136
MaeIII GTNAC 1 cut(s) 62
MnlI CCTC 1 cut(s) 5
MseI TTAA 1 cut(s) 17
MvnI CGCG 1 cut(s) 10
NlaIII CATG 1 cut(s) 70
NmuCI GTSAC 1 cut(s) 62
PfeI GAWTC 1 cut(s) 34
PkrI GCNGC 1 cut(s) 126
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
SaqAI TTAA 1 cut(s) 17
SatI GCNGC 1 cut(s) 125
SetI ASST 4 cut(s) 45, 52, 88, 103
SgeI CNNG 8 cut(s) 21, 23, 43, 79, 129, 133, 150, 158
TfiI GAWTC 1 cut(s) 34
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TseFI GTSAC 1 cut(s) 62
TseI GCWGC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 2 cut(s) 83, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.