pycom72g00050

Ribosomal protein S1-like RNA-binding domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000072
Physical Location & Seq
Reverse (-)
33869 .. 34069
201 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom72g00050.1

Sequence Viewer

Length: 201 bp
ATGGAAAGAGAAGCTAAGGGTATAAAACCAAGACAAATCGAAGAAGAAGAGACGAGCTTAAATGACGATGATGAAGATGATGACGACGATGACTTTGATTTCAGCTTCTTACACGACTCCAATGTTGATTTGTCGGACCAGCCTCTTGTTAACGGGACTGAGTCTGCAAGCATATCGGATGAAGGCATGTTCGAGGATTAA

Protein Analysis

67

Amino Acids

7.5

Weight (kDa)

4.05

Isoelectric Point (pI)

39.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021290)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 3 cut(s) 14, 57, 105
AluI AGCT 3 cut(s) 14, 57, 105
Alw26I GTCTC 1 cut(s) 44
ArsI GACNNNNNNTTYG 2 cut(s) 77, 109
AspS9I GGNCC 1 cut(s) 136
AvaII GGWCC 1 cut(s) 136
BcgI CGANNNNNNTGC 2 cut(s) 156, 190
BcoDI GTCTC 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 136
BmgT120I GGNCC 1 cut(s) 136
Bpu10I CCTNAGC 1 cut(s) 15
BseGI GGATG 1 cut(s) 184
BseMII CTCAG 1 cut(s) 150
BslFI GGGAC 1 cut(s) 169
BsmAI GTCTC 1 cut(s) 44
BsmBI CGTCTC 1 cut(s) 44
BsmFI GGGAC 1 cut(s) 169
BspCNI CTCAG 1 cut(s) 151
Bst6I CTCTTC 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 169
BstDEI CTNAG 2 cut(s) 15, 159
BstF5I GGATG 1 cut(s) 184
BstMAI GTCTC 1 cut(s) 44
BstNSI RCATGY 1 cut(s) 190
BtsCI GGATG 1 cut(s) 184
Cac8I GCNNGC 1 cut(s) 169
Cfr13I GGNCC 1 cut(s) 136
CviAII CATG 1 cut(s) 187
CviJI RGCY 4 cut(s) 14, 57, 105, 142
CviKI_1 RGCY 4 cut(s) 14, 57, 105, 142
DdeI CTNAG 2 cut(s) 15, 159
Eam1104I CTCTTC 1 cut(s) 42
EarI CTCTTC 1 cut(s) 42
Eco47I GGWCC 1 cut(s) 136
Esp3I CGTCTC 1 cut(s) 44
FaeI CATG 1 cut(s) 190
FaiI YATR 3 cut(s) 23, 173, 188
FaqI GGGAC 1 cut(s) 169
FatI CATG 1 cut(s) 186
FokI GGATG 1 cut(s) 191
Hin1II CATG 1 cut(s) 190
HincII GTYRAC 1 cut(s) 151
HindII GTYRAC 1 cut(s) 151
HinfI GANTC 2 cut(s) 116, 161
HpaI GTTAAC 1 cut(s) 151
Hpy166II GTNNAC 1 cut(s) 151
Hpy188I TCNGA 2 cut(s) 136, 178
Hpy8I GTNNAC 1 cut(s) 151
Hpy99I CGWCG 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 176
HpyCH4V TGCA 1 cut(s) 167
HpyF3I CTNAG 2 cut(s) 15, 159
Hsp92II CATG 1 cut(s) 190
KspAI GTTAAC 1 cut(s) 151
LpnPI CCDG 1 cut(s) 152
MboII GAAGA 4 cut(s) 53, 56, 59, 86
MlyI GAGTC 2 cut(s) 110, 170
MmeI TCCRAC 1 cut(s) 114
MnlI CCTC 2 cut(s) 153, 187
MseI TTAA 3 cut(s) 59, 150, 199
NlaIII CATG 1 cut(s) 190
NspI RCATGY 1 cut(s) 190
PflFI GACNNNGTC 1 cut(s) 160
PleI GAGTC 2 cut(s) 110, 169
PpsI GAGTC 2 cut(s) 110, 169
PspPI GGNCC 1 cut(s) 136
PsyI GACNNNGTC 1 cut(s) 160
SaqAI TTAA 3 cut(s) 59, 150, 199
Sau96I GGNCC 1 cut(s) 136
SchI GAGTC 2 cut(s) 110, 170
SetI ASST 3 cut(s) 16, 59, 107
SgeI CNNG 7 cut(s) 42, 66, 125, 151, 158, 166, 180
SinI GGWCC 1 cut(s) 136
TaqI TCGA 2 cut(s) 39, 192
Tru1I TTAA 3 cut(s) 59, 150, 199
Tru9I TTAA 3 cut(s) 59, 150, 199
TspDTI ATGAA 2 cut(s) 87, 195
Tth111I GACNNNGTC 1 cut(s) 160
VpaK11BI GGWCC 1 cut(s) 136
XceI RCATGY 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.