RchiOBHm_Chr5g0015841

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
10960438 .. 10960650
213 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGTGTTGGGTGGTTTTGCAAGGGGTGATGATTACGCTGTGCGCTCAGAAATACCTCTTGTTCTTGCTCTCCCTACAGATTCTGACTGAAAATGTCATAAGTGGGTTGTCAGTGTTTTCGCCACCTGTTAGAGCACTCATTTCGTTGCTTTACAGAGTTAGGAGAATCTTTGTCATCCTTGATTGGATATGTGAAGCATGTCGGCTGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.01

Weight (kDa)

8.91

Isoelectric Point (pI)

53.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7733 PF24867 18 - 65 1.4e-15 Domain of unknown function (DUF7733)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021419)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0015761 RchiOBHm_Chr5g0015841 RchiOBHm_Chr5g0015851
rosa_samantha Rh5CG132500
rosa_wichuraiana Rw5G010620

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw21I GWGCWC 1 cut(s) 136
AlwNI CAGNNNCTG 1 cut(s) 82
AspLEI GCGC 1 cut(s) 44
AsuHPI GGTGA 1 cut(s) 37
Bbv12I GWGCWC 1 cut(s) 136
BcgI CGANNNNNNTGC 2 cut(s) 123, 157
BfmI CTRYAG 1 cut(s) 74
BseGI GGATG 1 cut(s) 174
BseMII CTCAG 1 cut(s) 59
BsiHKAI GWGCWC 1 cut(s) 136
Bsp1286I GDGCHC 1 cut(s) 136
BspCNI CTCAG 1 cut(s) 58
BstC8I GCNNGC 1 cut(s) 207
BstDEI CTNAG 1 cut(s) 45
BstF5I GGATG 1 cut(s) 174
BstHHI GCGC 1 cut(s) 44
BstNSI RCATGY 1 cut(s) 201
BstSFI CTRYAG 1 cut(s) 74
BtsCI GGATG 1 cut(s) 174
BtsIMutI CAGTG 1 cut(s) 117
Cac8I GCNNGC 1 cut(s) 207
CaiI CAGNNNCTG 1 cut(s) 82
CfoI GCGC 1 cut(s) 44
CviAII CATG 1 cut(s) 198
CviJI RGCY 2 cut(s) 205, 209
CviKI_1 RGCY 2 cut(s) 205, 209
DdeI CTNAG 1 cut(s) 45
FaeI CATG 1 cut(s) 201
FaiI YATR 3 cut(s) 98, 190, 199
FatI CATG 1 cut(s) 197
FokI GGATG 1 cut(s) 161
GlaI GCGC 1 cut(s) 43
HhaI GCGC 1 cut(s) 44
Hin1II CATG 1 cut(s) 201
Hin6I GCGC 1 cut(s) 42
HinP1I GCGC 1 cut(s) 42
HinfI GANTC 2 cut(s) 79, 165
HphI GGTGA 1 cut(s) 37
Hpy188I TCNGA 2 cut(s) 48, 84
HpyCH4V TGCA 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 45
Hsp92II CATG 1 cut(s) 201
HspAI GCGC 1 cut(s) 42
LpnPI CCDG 2 cut(s) 138, 191
MhlI GDGCHC 1 cut(s) 136
MnlI CCTC 1 cut(s) 65
MseI TTAA 1 cut(s) 211
NlaIII CATG 1 cut(s) 201
NspI RCATGY 1 cut(s) 201
PfeI GAWTC 2 cut(s) 79, 165
PstNI CAGNNNCTG 1 cut(s) 82
SaqAI TTAA 1 cut(s) 211
SduI GDGCHC 1 cut(s) 136
SetI ASST 2 cut(s) 57, 127
SfcI CTRYAG 1 cut(s) 74
SgeI CNNG 5 cut(s) 32, 70, 76, 137, 191
TfiI GAWTC 2 cut(s) 79, 165
Tru1I TTAA 1 cut(s) 211
Tru9I TTAA 1 cut(s) 211
TscAI CASTG 1 cut(s) 117
TspRI CASTG 1 cut(s) 117
XceI RCATGY 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.