Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0021419

Physical Location & Seq

Genomic Coordinates Reverse (-)

10960438 .. 10960650

Gene Structure 213 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ29626

Sequence Viewer

CDS Protein Promoter (2k)

Length: 213 bp

ATGTGTTGGGTGGTTTTGCAAGGGGTGATGATTACGCTGTGCGCTCAGAAATACCTCTTGTTCTTGCTCTCCCTACAGATTCTGACTGAAAATGTCATAAGTGGGTTGTCAGTGTTTTCGCCACCTGTTAGAGCACTCATTTCGTTGCTTTACAGAGTTAGGAGAATCTTTGTCATCCTTGATTGGATATGTGAAGCATGTCGGCTGGCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

70

Amino Acids

8.01

Weight (kDa)

8.91

Isoelectric Point (pI)

53.42

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DUF7733	PF24867	18 - 65	1.4e-15	Domain of unknown function (DUF7733)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021419)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0015761 RchiOBHm_Chr5g0015841 RchiOBHm_Chr5g0015851
rosa_samantha	Rh5CG132500
rosa_wichuraiana	Rw5G010620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Alw21I	GWGCWC	1 cut(s)	136
AlwNI	CAGNNNCTG	1 cut(s)	82
AspLEI	GCGC	1 cut(s)	44
AsuHPI	GGTGA	1 cut(s)	37
Bbv12I	GWGCWC	1 cut(s)	136
BcgI	CGANNNNNNTGC	2 cut(s)	123, 157
BfmI	CTRYAG	1 cut(s)	74
BseGI	GGATG	1 cut(s)	174
BseMII	CTCAG	1 cut(s)	59
BsiHKAI	GWGCWC	1 cut(s)	136
Bsp1286I	GDGCHC	1 cut(s)	136
BspCNI	CTCAG	1 cut(s)	58
BstC8I	GCNNGC	1 cut(s)	207
BstDEI	CTNAG	1 cut(s)	45
BstF5I	GGATG	1 cut(s)	174
BstHHI	GCGC	1 cut(s)	44
BstNSI	RCATGY	1 cut(s)	201
BstSFI	CTRYAG	1 cut(s)	74
BtsCI	GGATG	1 cut(s)	174
BtsIMutI	CAGTG	1 cut(s)	117
Cac8I	GCNNGC	1 cut(s)	207
CaiI	CAGNNNCTG	1 cut(s)	82
CfoI	GCGC	1 cut(s)	44
CviAII	CATG	1 cut(s)	198
CviJI	RGCY	2 cut(s)	205, 209
CviKI_1	RGCY	2 cut(s)	205, 209
DdeI	CTNAG	1 cut(s)	45
FaeI	CATG	1 cut(s)	201
FaiI	YATR	3 cut(s)	98, 190, 199
FatI	CATG	1 cut(s)	197
FokI	GGATG	1 cut(s)	161
GlaI	GCGC	1 cut(s)	43
HhaI	GCGC	1 cut(s)	44
Hin1II	CATG	1 cut(s)	201
Hin6I	GCGC	1 cut(s)	42
HinP1I	GCGC	1 cut(s)	42
HinfI	GANTC	2 cut(s)	79, 165
HphI	GGTGA	1 cut(s)	37
Hpy188I	TCNGA	2 cut(s)	48, 84
HpyCH4V	TGCA	1 cut(s)	19
HpyF3I	CTNAG	1 cut(s)	45
Hsp92II	CATG	1 cut(s)	201
HspAI	GCGC	1 cut(s)	42
LpnPI	CCDG	2 cut(s)	138, 191
MhlI	GDGCHC	1 cut(s)	136
MnlI	CCTC	1 cut(s)	65
MseI	TTAA	1 cut(s)	211
NlaIII	CATG	1 cut(s)	201
NspI	RCATGY	1 cut(s)	201
PfeI	GAWTC	2 cut(s)	79, 165
PstNI	CAGNNNCTG	1 cut(s)	82
SaqAI	TTAA	1 cut(s)	211
SduI	GDGCHC	1 cut(s)	136
SetI	ASST	2 cut(s)	57, 127
SfcI	CTRYAG	1 cut(s)	74
SgeI	CNNG	5 cut(s)	32, 70, 76, 137, 191
TfiI	GAWTC	2 cut(s)	79, 165
Tru1I	TTAA	1 cut(s)	211
Tru9I	TTAA	1 cut(s)	211
TscAI	CASTG	1 cut(s)	117
TspRI	CASTG	1 cut(s)	117
XceI	RCATGY	1 cut(s)	201

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.