RchiOBHm_Chr5g0044981

BEST Arabidopsis thaliana protein match is glycine-rich protein (TAIR AT3G29075.1)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
40499451 .. 40499877
427 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 273 bp
ATGGCCTACTACAGCTCCAGCTACTATCAAACTGGTCATGATGATCATGGTGAGTATTACTTAACCTCTTATACTCATAATCCTGATGATTCTGCTCCAATTTCTTATTCTAGCTATGAAGATCCCAGCTTTCAGAACTTGCTTGAATATCAATATCCAAACCCAACTCCATATTATCATGCCAATTACCACTCTGCCTCTGCTTACAGCAACCCCATTTCAATTCAATATGACCCCCAAAATTCTATGAACAGAGTTATGAGACTGGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.55

Weight (kDa)

4.7

Isoelectric Point (pI)

34.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014424)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 116
AcsI RAATTY 1 cut(s) 241
AgsI TTSAA 3 cut(s) 146, 222, 227
AjuI GAANNNNNNNTTGG 2 cut(s) 91, 123
AluBI AGCT 4 cut(s) 15, 21, 114, 129
AluI AGCT 4 cut(s) 15, 21, 114, 129
Alw26I GTCTC 1 cut(s) 256
AlwI GGATC 1 cut(s) 116
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 241
AsuHPI GGTGA 1 cut(s) 62
BclI TGATCA 1 cut(s) 43
BcoDI GTCTC 1 cut(s) 256
BfaI CTAG 1 cut(s) 111
BfmI CTRYAG 1 cut(s) 10
BsaXI ACNNNNNCTCC 1 cut(s) 29
Bse1I ACTGG 2 cut(s) 37, 270
BseNI ACTGG 2 cut(s) 37, 270
BseYI CCCAGC 1 cut(s) 125
BshFI GGCC 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 256
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 2 cut(s) 43, 121
BspANI GGCC 1 cut(s) 5
BspHI TCATGA 1 cut(s) 37
BspPI GGATC 1 cut(s) 116
BsrI ACTGG 2 cut(s) 37, 270
BssMI GATC 2 cut(s) 43, 121
BstKTI GATC 2 cut(s) 46, 124
BstMAI GTCTC 1 cut(s) 256
BstMBI GATC 2 cut(s) 43, 121
BstSFI CTRYAG 1 cut(s) 10
BstX2I RGATCY 1 cut(s) 121
BstYI RGATCY 1 cut(s) 121
BsuRI GGCC 1 cut(s) 5
CciI TCATGA 1 cut(s) 37
CviAII CATG 3 cut(s) 38, 47, 179
CviJI RGCY 5 cut(s) 5, 15, 21, 114, 129
CviKI_1 RGCY 5 cut(s) 5, 15, 21, 114, 129
DpnI GATC 2 cut(s) 45, 123
DpnII GATC 2 cut(s) 43, 121
FaeI CATG 3 cut(s) 41, 50, 182
FatI CATG 3 cut(s) 37, 46, 178
FbaI TGATCA 1 cut(s) 43
FspBI CTAG 1 cut(s) 111
GsaI CCCAGC 1 cut(s) 129
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 3 cut(s) 41, 50, 182
HinfI GANTC 1 cut(s) 89
HphI GGTGA 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 135
Hpy188III TCNNGA 2 cut(s) 38, 83
Hsp92II CATG 3 cut(s) 41, 50, 182
Ksp22I TGATCA 1 cut(s) 43
Kzo9I GATC 2 cut(s) 43, 121
LmnI GCTCC 2 cut(s) 20, 100
LpnPI CCDG 5 cut(s) 18, 31, 96, 139, 251
MaeI CTAG 1 cut(s) 111
MalI GATC 2 cut(s) 45, 123
MboI GATC 2 cut(s) 43, 121
MboII GAAGA 1 cut(s) 131
MflI RGATCY 1 cut(s) 121
MluCI AATT 4 cut(s) 99, 184, 222, 241
MnlI CCTC 2 cut(s) 76, 208
MseI TTAA 1 cut(s) 62
NdeII GATC 2 cut(s) 43, 121
NlaIII CATG 3 cut(s) 41, 50, 182
PagI TCATGA 1 cut(s) 37
PfeI GAWTC 1 cut(s) 89
PspFI CCCAGC 1 cut(s) 125
PsuI RGATCY 1 cut(s) 121
SaqAI TTAA 1 cut(s) 62
Sau3AI GATC 2 cut(s) 43, 121
SetI ASST 5 cut(s) 17, 23, 68, 116, 131
SfcI CTRYAG 1 cut(s) 10
Sse9I AATT 4 cut(s) 99, 184, 222, 241
SspMI CTAG 1 cut(s) 111
TasI AATT 4 cut(s) 99, 184, 222, 241
TfiI GAWTC 1 cut(s) 89
Tru1I TTAA 1 cut(s) 62
Tru9I TTAA 1 cut(s) 62
TspDTI ATGAA 2 cut(s) 132, 263
XapI RAATTY 1 cut(s) 241
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.