RchiOBHm_Chr5g0058491

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
62923480 .. 62924391
912 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGCCGGAGCTGGATCCACCGCCTCCTGGCACACCGCTGCTGGCCCCGGCTCCTCCCTACCATCGAGGAGGATGCTTGGAACTATGCTTGTGGCTTCTGTGCTGCTGTGGTCTATTTAGTTGCTGCTGCCCTCCACTCTTTGAGTCTGGGCCGCCCCCACCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

5.7

Weight (kDa)

4.4

Isoelectric Point (pI)

88.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021162)

Species Orthologous Gene IDs
malus_domestica MD03G1120800.v1.1 MD11G1139600.v1.1
prunus_persica Prupe.6G104300_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0058491
rosa_samantha Rh5BG393300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 20, 35, 152
AclWI GGATC 2 cut(s) 8, 21
AfiI CCNNNNNNNGG 1 cut(s) 26
AjnI CCWGG 1 cut(s) 25
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
AlwI GGATC 2 cut(s) 8, 21
AoxI GGCC 2 cut(s) 42, 149
ApeKI GCWGC 4 cut(s) 37, 102, 123, 126
AspS9I GGNCC 2 cut(s) 43, 149
AsuC2I CCSGG 1 cut(s) 47
BamHI GGATCC 1 cut(s) 13
BbvI GCAGC 4 cut(s) 24, 89, 110, 113
BccI CCATC 1 cut(s) 69
BcgI CGANNNNNNTGC 2 cut(s) 54, 88
BciT130I CCWGG 1 cut(s) 27
BcnI CCSGG 1 cut(s) 47
BisI GCNGC 5 cut(s) 38, 103, 124, 127, 152
BlsI GCNGC 5 cut(s) 39, 104, 125, 128, 153
Bme1390I CCNGG 2 cut(s) 27, 47
BmgT120I GGNCC 2 cut(s) 43, 149
BmiI GGNNCC 3 cut(s) 15, 45, 51
BmrFI CCNGG 2 cut(s) 27, 47
BmsI GCATC 1 cut(s) 62
BpuMI CCSGG 1 cut(s) 47
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 26
BseBI CCWGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 45
BseGI GGATG 1 cut(s) 77
BseLI CCNNNNNNNGG 1 cut(s) 26
BseRI GAGGAG 2 cut(s) 42, 81
BseXI GCAGC 4 cut(s) 24, 89, 110, 113
BshFI GGCC 2 cut(s) 44, 151
BsiSI CCGG 2 cut(s) 5, 47
BslI CCNNNNNNNGG 1 cut(s) 26
BsnI GGCC 2 cut(s) 44, 151
Bsp143I GATC 1 cut(s) 13
BspACI CCGC 3 cut(s) 20, 35, 152
BspANI GGCC 2 cut(s) 44, 151
BspLI GGNNCC 3 cut(s) 15, 45, 51
BspPI GGATC 2 cut(s) 8, 21
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 27
BstC8I GCNNGC 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 162
BstF5I GGATG 1 cut(s) 77
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstNI CCWGG 1 cut(s) 27
BstSCI CCNGG 2 cut(s) 25, 45
BstV1I GCAGC 4 cut(s) 24, 89, 110, 113
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BsuRI GGCC 2 cut(s) 44, 151
BtsCI GGATG 1 cut(s) 77
Cac8I GCNNGC 1 cut(s) 42
Cfr13I GGNCC 2 cut(s) 43, 149
CviJI RGCY 5 cut(s) 10, 44, 50, 94, 151
CviKI_1 RGCY 5 cut(s) 10, 44, 50, 94, 151
DdeI CTNAG 1 cut(s) 162
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
EcoRII CCWGG 1 cut(s) 25
FaiI YATR 1 cut(s) 85
Fnu4HI GCNGC 5 cut(s) 38, 103, 124, 127, 152
FokI GGATG 1 cut(s) 84
Fsp4HI GCNGC 5 cut(s) 38, 103, 124, 127, 152
GluI GCNGC 5 cut(s) 38, 103, 124, 127, 152
HaeIII GGCC 2 cut(s) 44, 151
HapII CCGG 2 cut(s) 5, 47
HinfI GANTC 1 cut(s) 143
HpaII CCGG 2 cut(s) 5, 47
HpyF3I CTNAG 1 cut(s) 162
Kzo9I GATC 1 cut(s) 13
LmnI GCTCC 2 cut(s) 7, 55
LpnPI CCDG 6 cut(s) 12, 18, 26, 39, 60, 132
Lsp1109I GCAGC 4 cut(s) 24, 89, 110, 113
LweI GCATC 1 cut(s) 62
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MflI RGATCY 1 cut(s) 13
MlyI GAGTC 1 cut(s) 152
MnlI CCTC 5 cut(s) 33, 59, 62, 63, 141
MspA1I CMGCKG 1 cut(s) 37
MspI CCGG 2 cut(s) 5, 47
MspR9I CCNGG 2 cut(s) 27, 47
MvaI CCWGG 1 cut(s) 27
NciI CCSGG 1 cut(s) 47
NdeII GATC 1 cut(s) 13
NlaIV GGNNCC 3 cut(s) 15, 45, 51
PkrI GCNGC 5 cut(s) 39, 104, 125, 128, 153
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
Psp6I CCWGG 1 cut(s) 25
PspGI CCWGG 1 cut(s) 25
PspN4I GGNNCC 3 cut(s) 15, 45, 51
PspPI GGNCC 2 cut(s) 43, 149
PsuI RGATCY 1 cut(s) 13
SatI GCNGC 5 cut(s) 38, 103, 124, 127, 152
Sau3AI GATC 1 cut(s) 13
Sau96I GGNCC 2 cut(s) 43, 149
SchI GAGTC 1 cut(s) 152
ScrFI CCNGG 2 cut(s) 27, 47
SetI ASST 2 cut(s) 12, 163
SfaNI GCATC 1 cut(s) 62
SsiI CCGC 3 cut(s) 20, 35, 152
StyD4I CCNGG 2 cut(s) 25, 45
TaqI TCGA 1 cut(s) 64
TauI GCSGC 1 cut(s) 154
TseI GCWGC 4 cut(s) 37, 102, 123, 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.