RchiOBHm_Chr4g0439751

Belongs to the RNase T2 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
62115580 .. 62115795
216 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 216 bp
ATGGGAAAGTTTAACTTAAACAGTCTAATTATAAATAATCTGCAATCATCATTTGGCTTACGCAGTGTAGGGATAGAATGCAATGAAGATGCACATGGTAATAGCCAGTTTTCCCAAGTTTATCTTTGTATAGACCCTTCTGGTTATTCTCTCACTGACTGTCCAGTGCTGCCAGATGCAAAATGTTCCAACAGTGTGGTGTTTCCTTCCTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.69

Weight (kDa)

4.52

Isoelectric Point (pI)

56.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019010)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0439751
rosa_laevigata RLG00000006239
rosa_rugosa Rorug04G0321400
rosa_samantha Rh4AG372300 Rh4BG384600 Rh4CG399100 Rh4DG378800
rosa_wichuraiana Rw4G031790 Rw4G031810

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 32
ApeKI GCWGC 1 cut(s) 169
BarI GAAGNNNNNNTAC 2 cut(s) 121, 153
BbvI GCAGC 1 cut(s) 156
BisI GCNGC 1 cut(s) 170
BlsI GCNGC 1 cut(s) 171
BmsI GCATC 2 cut(s) 79, 166
Bse1I ACTGG 2 cut(s) 106, 164
Bse3DI GCAATG 1 cut(s) 88
BseMI GCAATG 1 cut(s) 88
BseNI ACTGG 2 cut(s) 106, 164
BseXI GCAGC 1 cut(s) 156
BsmI GAATGC 1 cut(s) 83
BsrDI GCAATG 1 cut(s) 88
BsrI ACTGG 2 cut(s) 106, 164
Bst4CI ACNGT 3 cut(s) 23, 161, 194
BstV1I GCAGC 1 cut(s) 156
BstXI CCANNNNNNTGG 1 cut(s) 196
BtsI GCAGTG 1 cut(s) 70
BtsIMutI CAGTG 4 cut(s) 70, 153, 171, 199
CviAII CATG 1 cut(s) 95
CviJI RGCY 2 cut(s) 57, 105
CviKI_1 RGCY 2 cut(s) 57, 105
FaeI CATG 1 cut(s) 98
FaiI YATR 3 cut(s) 32, 96, 131
FalI AAGNNNNNCTT 3 cut(s) 31, 108, 140
FatI CATG 1 cut(s) 94
Fnu4HI GCNGC 1 cut(s) 170
Fsp4HI GCNGC 1 cut(s) 170
GluI GCNGC 1 cut(s) 170
Hin1II CATG 1 cut(s) 98
HpyAV CCTTC 2 cut(s) 147, 216
HpyCH4III ACNGT 3 cut(s) 23, 161, 194
HpyCH4V TGCA 4 cut(s) 43, 81, 92, 179
Hsp92II CATG 1 cut(s) 98
LpnPI CCDG 4 cut(s) 119, 126, 177, 186
Lsp1109I GCAGC 1 cut(s) 156
LweI GCATC 2 cut(s) 79, 166
MboII GAAGA 1 cut(s) 98
MluCI AATT 1 cut(s) 27
MmeI TCCRAC 1 cut(s) 213
MseI TTAA 2 cut(s) 12, 17
Mva1269I GAATGC 1 cut(s) 83
NlaIII CATG 1 cut(s) 98
PctI GAATGC 1 cut(s) 83
PkrI GCNGC 1 cut(s) 171
PsiI TTATAA 1 cut(s) 32
SaqAI TTAA 2 cut(s) 12, 17
SatI GCNGC 1 cut(s) 170
SfaNI GCATC 2 cut(s) 79, 166
SgeI CNNG 6 cut(s) 107, 118, 128, 153, 176, 185
Sse9I AATT 1 cut(s) 27
TaaI ACNGT 3 cut(s) 23, 161, 194
TasI AATT 1 cut(s) 27
Tru1I TTAA 2 cut(s) 12, 17
Tru9I TTAA 2 cut(s) 12, 17
TscAI CASTG 4 cut(s) 70, 160, 171, 199
TseI GCWGC 1 cut(s) 169
TspDTI ATGAA 1 cut(s) 99
TspRI CASTG 4 cut(s) 70, 160, 171, 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.