RchiOBHm_Chr4g0439851

clavata3 esr-related 45

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
62172654 .. 62173203
550 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 267 bp
ATGGTGTCGAGTAATCATAGAGTGTTTATCCTTGCTATCTGTATTGGGTTGTTAGTATTTCAACCAAGTGAAGTTTCTGGCCTTAGAAGTATAGGCGTTGCGCTAAGACTGAATCAAGAACATCATCGGATTCTTAAGGCTGTCGTCACTGAAGAAATGAACACAGGTAAGAAGAATTCAACAAGAACAAACAAGAATTTTGATCCAAATCAATCAAGCAAAAGAAGGGTGAGAAGAGGATCAGATCCTATCCACAACCGGGCTTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.93

Weight (kDa)

11.44

Isoelectric Point (pI)

60.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 197, 239, 247
AcsI RAATTY 2 cut(s) 175, 196
AcuI CTGAAG 1 cut(s) 171
AfiI CCNNNNNNNGG 1 cut(s) 259
AflII CTTAAG 1 cut(s) 134
AgsI TTSAA 2 cut(s) 62, 180
AjuI GAANNNNNNNTTGG 2 cut(s) 58, 90
AlwI GGATC 3 cut(s) 197, 239, 247
AoxI GGCC 1 cut(s) 79
ApoI RAATTY 2 cut(s) 175, 196
AspLEI GCGC 1 cut(s) 103
AsuC2I CCSGG 1 cut(s) 260
AsuHPI GGTGA 1 cut(s) 241
BcnI CCSGG 1 cut(s) 260
BfrI CTTAAG 1 cut(s) 134
Bme1390I CCNGG 1 cut(s) 260
BmrFI CCNGG 1 cut(s) 260
BpuMI CCSGG 1 cut(s) 260
BsaBI GATNNNNATC 1 cut(s) 207
Bsc4I CCNNNNNNNGG 1 cut(s) 259
Bse8I GATNNNNATC 1 cut(s) 207
BseJI GATNNNNATC 1 cut(s) 207
BseLI CCNNNNNNNGG 1 cut(s) 259
BshFI GGCC 1 cut(s) 81
BsiSI CCGG 1 cut(s) 259
BslI CCNNNNNNNGG 1 cut(s) 259
BsnI GGCC 1 cut(s) 81
Bsp143I GATC 3 cut(s) 202, 239, 244
BspANI GGCC 1 cut(s) 81
BspPI GGATC 3 cut(s) 197, 239, 247
BspTI CTTAAG 1 cut(s) 134
BssMI GATC 3 cut(s) 202, 239, 244
Bst6I CTCTTC 1 cut(s) 229
BstAFI CTTAAG 1 cut(s) 134
BstDEI CTNAG 3 cut(s) 83, 104, 264
BstHHI GCGC 1 cut(s) 103
BstKTI GATC 3 cut(s) 205, 242, 247
BstMBI GATC 3 cut(s) 202, 239, 244
BstSCI CCNGG 1 cut(s) 258
BstX2I RGATCY 1 cut(s) 244
BstYI RGATCY 1 cut(s) 244
BsuRI GGCC 1 cut(s) 81
BtsIMutI CAGTG 1 cut(s) 147
CfoI GCGC 1 cut(s) 103
CviJI RGCY 3 cut(s) 81, 140, 263
CviKI_1 RGCY 3 cut(s) 81, 140, 263
DdeI CTNAG 3 cut(s) 83, 104, 264
DpnI GATC 3 cut(s) 204, 241, 246
DpnII GATC 3 cut(s) 202, 239, 244
Eam1104I CTCTTC 1 cut(s) 229
EarI CTCTTC 1 cut(s) 229
Eco57I CTGAAG 1 cut(s) 171
EcoRI GAATTC 1 cut(s) 175
FaiI YATR 2 cut(s) 18, 92
GlaI GCGC 1 cut(s) 102
HaeIII GGCC 1 cut(s) 81
HapII CCGG 1 cut(s) 259
HhaI GCGC 1 cut(s) 103
Hin6I GCGC 1 cut(s) 101
HinP1I GCGC 1 cut(s) 101
HinfI GANTC 2 cut(s) 112, 130
HpaII CCGG 1 cut(s) 259
HphI GGTGA 1 cut(s) 241
Hpy188I TCNGA 2 cut(s) 129, 244
Hpy188III TCNNGA 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 219
HpyF3I CTNAG 3 cut(s) 83, 104, 264
HspAI GCGC 1 cut(s) 101
Kzo9I GATC 3 cut(s) 202, 239, 244
LpnPI CCDG 2 cut(s) 63, 150
MaeIII GTNAC 1 cut(s) 145
MalI GATC 3 cut(s) 204, 241, 246
MboI GATC 3 cut(s) 202, 239, 244
MboII GAAGA 3 cut(s) 164, 184, 246
MflI RGATCY 1 cut(s) 244
MluCI AATT 2 cut(s) 175, 196
MnlI CCTC 1 cut(s) 230
MseI TTAA 1 cut(s) 135
MspCI CTTAAG 1 cut(s) 134
MspI CCGG 1 cut(s) 259
MspR9I CCNGG 1 cut(s) 260
NciI CCSGG 1 cut(s) 260
NdeII GATC 3 cut(s) 202, 239, 244
NmuCI GTSAC 1 cut(s) 145
PfeI GAWTC 2 cut(s) 112, 130
PsuI RGATCY 1 cut(s) 244
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 3 cut(s) 202, 239, 244
ScrFI CCNGG 1 cut(s) 260
SetI ASST 1 cut(s) 169
SgeI CNNG 9 cut(s) 21, 44, 78, 90, 128, 177, 195, 205, 228
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
Sse9I AATT 2 cut(s) 175, 196
StyD4I CCNGG 1 cut(s) 258
TaqI TCGA 1 cut(s) 8
TasI AATT 2 cut(s) 175, 196
TfiI GAWTC 2 cut(s) 112, 130
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TscAI CASTG 1 cut(s) 154
TseFI GTSAC 1 cut(s) 145
Tsp45I GTSAC 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 173
TspRI CASTG 1 cut(s) 154
Vha464I CTTAAG 1 cut(s) 134
XapI RAATTY 2 cut(s) 175, 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.