RchiOBHm_Chr2g0168191

SWR1 complex subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
82626471 .. 82627731
1261 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGTTCTGGAATCAGGAGGCTCTTAAAGAGGAAGAAGATGATAACTATGAAGTGGAGCTGAAAGTTACTGATTTGTTTGATAATGACTTTGTGAAAGATTTCCTAAGCTGGATTGAGCGATGCTGTGATTTGGTGTTGAAGCATCTTTCAGTCATGCAGAAACAAAGATGCTGA

Protein Analysis

57

Amino Acids

6.99

Weight (kDa)

4.39

Isoelectric Point (pI)

33.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 139
AluBI AGCT 2 cut(s) 58, 108
AluI AGCT 2 cut(s) 58, 108
Asp700I GAANNNNTTC 1 cut(s) 98
BmsI GCATC 3 cut(s) 110, 151, 158
Bpu10I CCTNAGC 1 cut(s) 104
BstDEI CTNAG 1 cut(s) 104
BtgZI GCGATG 1 cut(s) 133
CviAII CATG 1 cut(s) 154
CviJI RGCY 3 cut(s) 20, 58, 108
CviKI_1 RGCY 3 cut(s) 20, 58, 108
DdeI CTNAG 1 cut(s) 104
FaeI CATG 1 cut(s) 157
FaiI YATR 2 cut(s) 48, 155
FatI CATG 1 cut(s) 153
FspEI CC 6 cut(s) 2, 14, 38, 94, 116, 116
Hin1II CATG 1 cut(s) 157
HinfI GANTC 1 cut(s) 10
Hpy188III TCNNGA 2 cut(s) 7, 14
HpyCH4V TGCA 1 cut(s) 157
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 1 cut(s) 157
LmnI GCTCC 1 cut(s) 55
LpnPI CCDG 1 cut(s) 94
LweI GCATC 3 cut(s) 110, 151, 158
MaeIII GTNAC 1 cut(s) 64
MboII GAAGA 2 cut(s) 44, 47
MnlI CCTC 2 cut(s) 10, 22
MroXI GAANNNNTTC 1 cut(s) 98
MseI TTAA 1 cut(s) 24
NlaIII CATG 1 cut(s) 157
PdmI GAANNNNTTC 1 cut(s) 98
PfeI GAWTC 1 cut(s) 10
SaqAI TTAA 1 cut(s) 24
SetI ASST 2 cut(s) 60, 110
SfaNI GCATC 3 cut(s) 110, 151, 158
SgeI CNNG 4 cut(s) 19, 26, 121, 166
TfiI GAWTC 1 cut(s) 10
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TspDTI ATGAA 1 cut(s) 63
XmnI GAANNNNTTC 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.