RchiOBHm_Chr1g0322261

urease accessory protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0019840
Physical Location & Seq
Reverse (-)
9685632 .. 9686142
511 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 384 bp
ATGAGAGTGGCTGCAGCACTAGTTTATTCAGAAATACCGTTTCTTAAATCTATGAGGGAAACTTCTTTAAGTAATGGAGTTGTTTCTTTTCACCATGCTCCTATATATGGGCTTATATGTGGATTGCTTCGGTTGGATAGCAGTACTTCTCAAAGAGCTTTCATGTTTTTCACAATGAGAGATGTTATTTCTGCTGCAACAAGGCTGAATTTGGTCGGACCCCTAGGTGCGGCTGTTCTGCAACATCATATAGCTCCTATCTCTGAAGCTATACTGAATCAATGGAAGGACATTCCAGTTGAGGAAGCATGCCAAACTGTTCCTTTGCTTGATATCGTGCAGGGTTGTCATAGCTACCTGTTTTCTAGACTGTTCTGTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0006807 GO:0008150 GO:0008152 GO:0043085 GO:0044093 GO:0050790 GO:0051336 GO:0051345 GO:0065007 GO:0065009 GO:1905181 GO:1905182
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UreF

Protein Analysis

127

Amino Acids

14.02

Weight (kDa)

6.95

Isoelectric Point (pI)

37.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UreF PF01730 19 - 84 1.5e-09 UreF
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019840)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0322261 RchiOBHm_Chr1g0323071
rosa_laevigata RLG00000015499 RLG00000030368
rosa_multiflora Rmu_sc0004185.1_g000007
rosa_samantha Rh1AG050400 Rh1DG056900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 230
AcsI RAATTY 1 cut(s) 208
AcuI CTGAAG 1 cut(s) 285
AfaI GTAC 1 cut(s) 145
AfiI CCNNNNNNNGG 2 cut(s) 107, 229
AhlI ACTAGT 1 cut(s) 19
AluBI AGCT 4 cut(s) 158, 254, 269, 354
AluI AGCT 4 cut(s) 158, 254, 269, 354
ApeKI GCWGC 3 cut(s) 11, 14, 194
ApoI RAATTY 1 cut(s) 208
AspA2I CCTAGG 1 cut(s) 223
AspS9I GGNCC 1 cut(s) 218
AsuHPI GGTGA 1 cut(s) 83
AvaII GGWCC 1 cut(s) 218
AvrII CCTAGG 1 cut(s) 223
BbvI GCAGC 2 cut(s) 26, 181
BcuI ACTAGT 1 cut(s) 19
BfaI CTAG 3 cut(s) 20, 224, 366
BfmI CTRYAG 1 cut(s) 12
BisI GCNGC 4 cut(s) 12, 15, 195, 231
BlnI CCTAGG 1 cut(s) 223
BlsI GCNGC 4 cut(s) 13, 16, 196, 232
BmcAI AGTACT 1 cut(s) 145
Bme18I GGWCC 1 cut(s) 218
BmgT120I GGNCC 1 cut(s) 218
BmiI GGNNCC 1 cut(s) 220
BsaJI CCNNGG 1 cut(s) 223
Bsc4I CCNNNNNNNGG 2 cut(s) 107, 229
Bse1I ACTGG 1 cut(s) 296
BseDI CCNNGG 1 cut(s) 223
BseLI CCNNNNNNNGG 2 cut(s) 107, 229
BseNI ACTGG 1 cut(s) 296
BseXI GCAGC 2 cut(s) 26, 181
BsgI GTGCAG 1 cut(s) 359
BslI CCNNNNNNNGG 2 cut(s) 107, 229
BspACI CCGC 1 cut(s) 230
BspLI GGNNCC 1 cut(s) 220
BspMAI CTGCAG 1 cut(s) 16
BsrI ACTGG 1 cut(s) 296
BssECI CCNNGG 1 cut(s) 223
BssT1I CCWWGG 1 cut(s) 223
Bst4CI ACNGT 3 cut(s) 39, 319, 372
BstC8I GCNNGC 1 cut(s) 310
BstNSI RCATGY 1 cut(s) 312
BstSFI CTRYAG 1 cut(s) 12
BstV1I GCAGC 2 cut(s) 26, 181
Cac8I GCNNGC 1 cut(s) 310
Cfr13I GGNCC 1 cut(s) 218
Csp6I GTAC 1 cut(s) 144
CviAII CATG 3 cut(s) 95, 163, 309
CviJI RGCY 8 cut(s) 11, 112, 158, 205, 233, 254, 269, 354
CviKI_1 RGCY 8 cut(s) 11, 112, 158, 205, 233, 254, 269, 354
CviQI GTAC 1 cut(s) 144
Eco130I CCWWGG 1 cut(s) 223
Eco32I GATATC 1 cut(s) 334
Eco47I GGWCC 1 cut(s) 218
Eco57I CTGAAG 1 cut(s) 285
EcoRV GATATC 1 cut(s) 334
EcoT14I CCWWGG 1 cut(s) 223
ErhI CCWWGG 1 cut(s) 223
FaeI CATG 3 cut(s) 98, 166, 312
FatI CATG 3 cut(s) 94, 162, 308
Fnu4HI GCNGC 4 cut(s) 12, 15, 195, 231
Fsp4HI GCNGC 4 cut(s) 12, 15, 195, 231
FspBI CTAG 3 cut(s) 20, 224, 366
GluI GCNGC 4 cut(s) 12, 15, 195, 231
Hin1II CATG 3 cut(s) 98, 166, 312
HinfI GANTC 1 cut(s) 277
HphI GGTGA 1 cut(s) 83
Hpy188I TCNGA 3 cut(s) 31, 218, 265
Hpy188III TCNNGA 2 cut(s) 366, 381
HpyAV CCTTC 1 cut(s) 280
HpyCH4III ACNGT 3 cut(s) 39, 319, 372
HpyCH4V TGCA 4 cut(s) 14, 197, 241, 340
Hsp92II CATG 3 cut(s) 98, 166, 312
LmnI GCTCC 2 cut(s) 103, 259
LpnPI CCDG 3 cut(s) 309, 326, 371
Lsp1109I GCAGC 2 cut(s) 26, 181
MaeI CTAG 3 cut(s) 20, 224, 366
MluCI AATT 1 cut(s) 208
MmeI TCCRAC 2 cut(s) 114, 196
MnlI CCTC 2 cut(s) 48, 295
MseI TTAA 2 cut(s) 45, 68
NlaIII CATG 3 cut(s) 98, 166, 312
NlaIV GGNNCC 1 cut(s) 220
NspI RCATGY 1 cut(s) 312
PaeI GCATGC 1 cut(s) 312
PfeI GAWTC 1 cut(s) 277
PkrI GCNGC 4 cut(s) 13, 16, 196, 232
PspN4I GGNNCC 1 cut(s) 220
PspPI GGNCC 1 cut(s) 218
PstI CTGCAG 1 cut(s) 16
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
SaqAI TTAA 2 cut(s) 45, 68
SatI GCNGC 4 cut(s) 12, 15, 195, 231
Sau96I GGNCC 1 cut(s) 218
ScaI AGTACT 1 cut(s) 145
SetI ASST 6 cut(s) 160, 229, 256, 271, 356, 360
SfcI CTRYAG 1 cut(s) 12
SinI GGWCC 1 cut(s) 218
SpeI ACTAGT 1 cut(s) 19
SphI GCATGC 1 cut(s) 312
Sse9I AATT 1 cut(s) 208
SsiI CCGC 1 cut(s) 230
SspMI CTAG 3 cut(s) 20, 224, 366
StyI CCWWGG 1 cut(s) 223
TaaI ACNGT 3 cut(s) 39, 319, 372
TasI AATT 1 cut(s) 208
TatI WGTACW 1 cut(s) 143
TauI GCSGC 1 cut(s) 233
TfiI GAWTC 1 cut(s) 277
Tru1I TTAA 2 cut(s) 45, 68
Tru9I TTAA 2 cut(s) 45, 68
TseI GCWGC 3 cut(s) 11, 14, 194
TspDTI ATGAA 1 cut(s) 151
VpaK11BI GGWCC 1 cut(s) 218
XapI RAATTY 1 cut(s) 208
XbaI TCTAGA 1 cut(s) 365
XceI RCATGY 1 cut(s) 312
XmaJI CCTAGG 1 cut(s) 223
XspI CTAG 3 cut(s) 20, 224, 366
ZrmI AGTACT 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.