Rmu_sc0004185.1_g000007

urease accessory protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004185.1
Physical Location & Seq
Reverse (-)
31415 .. 31795
381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004185.1_g000007.1.cds

Sequence Viewer

Length: 381 bp
atgagagtggctgcagcagtgtattcagaaataccgtctcttaaatctatgagggaaacttctttatgtaatggagttgtttcttttcatcgttctcctatgtatgggcttatatgtggattgcttgggttggatagcagtacttctcaaagagctttcatgtttatcacaatgagagattttatttttgccgcaacaaggctgaatttggtcggaccccttggtgcggctgttctgcaacatcatattgctcctatctctgaagctatactgaatcaatggaaggacattccagttgaggaagcatgccaaactgttcctttgcttgatatcgtgcagggttgtcatagctacctgttttctagaccattctgttcttga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

13.88

Weight (kDa)

6.88

Isoelectric Point (pI)

45.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019840)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 192, 227
AcsI RAATTY 1 cut(s) 205
AcuI CTGAAG 1 cut(s) 282
AfaI GTAC 1 cut(s) 142
AfiI CCNNNNNNNGG 3 cut(s) 104, 198, 226
AluBI AGCT 3 cut(s) 155, 266, 351
AluI AGCT 3 cut(s) 155, 266, 351
Alw26I GTCTC 1 cut(s) 42
ApeKI GCWGC 2 cut(s) 11, 14
ApoI RAATTY 1 cut(s) 205
AspS9I GGNCC 1 cut(s) 215
AvaII GGWCC 1 cut(s) 215
BbvI GCAGC 1 cut(s) 26
BcoDI GTCTC 1 cut(s) 42
BfaI CTAG 1 cut(s) 363
BfmI CTRYAG 1 cut(s) 12
BisI GCNGC 4 cut(s) 12, 15, 192, 228
BlsI GCNGC 4 cut(s) 13, 16, 193, 229
BmcAI AGTACT 1 cut(s) 142
Bme18I GGWCC 1 cut(s) 215
BmgT120I GGNCC 1 cut(s) 215
BmiI GGNNCC 1 cut(s) 217
BsaJI CCNNGG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 3 cut(s) 104, 198, 226
Bse1I ACTGG 1 cut(s) 293
BseDI CCNNGG 1 cut(s) 220
BseLI CCNNNNNNNGG 3 cut(s) 104, 198, 226
BseNI ACTGG 1 cut(s) 293
BseXI GCAGC 1 cut(s) 26
BsgI GTGCAG 1 cut(s) 356
BslI CCNNNNNNNGG 3 cut(s) 104, 198, 226
BsmAI GTCTC 1 cut(s) 42
BsmBI CGTCTC 1 cut(s) 42
BspACI CCGC 2 cut(s) 192, 227
BspLI GGNNCC 1 cut(s) 217
BspMAI CTGCAG 1 cut(s) 16
BsrI ACTGG 1 cut(s) 293
BssECI CCNNGG 1 cut(s) 220
BssT1I CCWWGG 1 cut(s) 220
Bst4CI ACNGT 2 cut(s) 36, 316
BstC8I GCNNGC 1 cut(s) 307
BstMAI GTCTC 1 cut(s) 42
BstNSI RCATGY 1 cut(s) 309
BstSFI CTRYAG 1 cut(s) 12
BstV1I GCAGC 1 cut(s) 26
BtsI GCAGTG 1 cut(s) 24
BtsIMutI CAGTG 1 cut(s) 24
Cac8I GCNNGC 1 cut(s) 307
Cfr13I GGNCC 1 cut(s) 215
Csp6I GTAC 1 cut(s) 141
CviAII CATG 2 cut(s) 160, 306
CviJI RGCY 7 cut(s) 11, 109, 155, 202, 230, 266, 351
CviKI_1 RGCY 7 cut(s) 11, 109, 155, 202, 230, 266, 351
CviQI GTAC 1 cut(s) 141
Eco130I CCWWGG 1 cut(s) 220
Eco32I GATATC 1 cut(s) 331
Eco47I GGWCC 1 cut(s) 215
Eco57I CTGAAG 1 cut(s) 282
EcoRV GATATC 1 cut(s) 331
EcoT14I CCWWGG 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 220
Esp3I CGTCTC 1 cut(s) 42
FaeI CATG 2 cut(s) 163, 309
FatI CATG 2 cut(s) 159, 305
Fnu4HI GCNGC 4 cut(s) 12, 15, 192, 228
Fsp4HI GCNGC 4 cut(s) 12, 15, 192, 228
FspBI CTAG 1 cut(s) 363
GluI GCNGC 4 cut(s) 12, 15, 192, 228
Hin1II CATG 2 cut(s) 163, 309
HinfI GANTC 1 cut(s) 274
Hpy188I TCNGA 3 cut(s) 28, 215, 262
Hpy188III TCNNGA 2 cut(s) 363, 378
HpyAV CCTTC 1 cut(s) 277
HpyCH4III ACNGT 2 cut(s) 36, 316
HpyCH4V TGCA 3 cut(s) 14, 238, 337
Hsp92II CATG 2 cut(s) 163, 309
LmnI GCTCC 1 cut(s) 256
LpnPI CCDG 3 cut(s) 306, 323, 368
Lsp1109I GCAGC 1 cut(s) 26
MaeI CTAG 1 cut(s) 363
MluCI AATT 1 cut(s) 205
MmeI TCCRAC 2 cut(s) 111, 193
MnlI CCTC 2 cut(s) 45, 292
MseI TTAA 1 cut(s) 42
NlaIII CATG 2 cut(s) 163, 309
NlaIV GGNNCC 1 cut(s) 217
NspI RCATGY 1 cut(s) 309
PaeI GCATGC 1 cut(s) 309
PfeI GAWTC 1 cut(s) 274
PkrI GCNGC 4 cut(s) 13, 16, 193, 229
PspN4I GGNNCC 1 cut(s) 217
PspPI GGNCC 1 cut(s) 215
PstI CTGCAG 1 cut(s) 16
RsaI GTAC 1 cut(s) 142
RsaNI GTAC 1 cut(s) 141
SaqAI TTAA 1 cut(s) 42
SatI GCNGC 4 cut(s) 12, 15, 192, 228
Sau96I GGNCC 1 cut(s) 215
ScaI AGTACT 1 cut(s) 142
SetI ASST 4 cut(s) 157, 268, 353, 357
SfcI CTRYAG 1 cut(s) 12
SinI GGWCC 1 cut(s) 215
SphI GCATGC 1 cut(s) 309
Sse9I AATT 1 cut(s) 205
SsiI CCGC 2 cut(s) 192, 227
SspMI CTAG 1 cut(s) 363
StyI CCWWGG 1 cut(s) 220
TaaI ACNGT 2 cut(s) 36, 316
TasI AATT 1 cut(s) 205
TatI WGTACW 1 cut(s) 140
TauI GCSGC 2 cut(s) 194, 230
TfiI GAWTC 1 cut(s) 274
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TscAI CASTG 1 cut(s) 24
TseI GCWGC 2 cut(s) 11, 14
TspDTI ATGAA 2 cut(s) 77, 148
TspRI CASTG 1 cut(s) 24
VpaK11BI GGWCC 1 cut(s) 215
XapI RAATTY 1 cut(s) 205
XbaI TCTAGA 1 cut(s) 362
XceI RCATGY 1 cut(s) 309
XspI CTAG 1 cut(s) 363
ZrmI AGTACT 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.