RchiOBHm_Chr1g0329521

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
19199472 .. 19201564
2093 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 135 bp
ATGTTCCAACTTCTGTGGTCTGTGCTTGGTCGTCATTGGTATACAGTCCCTGGTGGAAGGAAGGTTTATGTTGGTAAAACTGGGCAGGAATTGACAGGTCAAACAGCCCACAGACTATGCTCAAAGGAAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

44

Amino Acids

5.01

Weight (kDa)

9.86

Isoelectric Point (pI)

19.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 41
AjnI CCWGG 1 cut(s) 49
AlwNI CAGNNNCTG 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 51
Bme1390I CCNGG 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 51
BmrI ACTGGG 1 cut(s) 90
BmuI ACTGGG 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 49
Bse1I ACTGG 1 cut(s) 85
BseBI CCWGG 1 cut(s) 51
BseDI CCNNGG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 85
BslFI GGGAC 1 cut(s) 32
BsmFI GGGAC 1 cut(s) 32
BsrI ACTGG 1 cut(s) 85
BssECI CCNNGG 1 cut(s) 49
BssNAI GTATAC 1 cut(s) 42
Bst1107I GTATAC 1 cut(s) 42
Bst2UI CCWGG 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 46
BstNI CCWGG 1 cut(s) 51
BstSCI CCNGG 1 cut(s) 49
BstZ17I GTATAC 1 cut(s) 42
CaiI CAGNNNCTG 1 cut(s) 50
CspCI CAANNNNNGTGG 1 cut(s) 31
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
EcoRII CCWGG 1 cut(s) 49
FaiI YATR 3 cut(s) 42, 69, 118
FaqI GGGAC 1 cut(s) 32
FblI GTMKAC 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 42
Hpy8I GTNNAC 1 cut(s) 42
HpyAV CCTTC 2 cut(s) 51, 55
HpyCH4III ACNGT 1 cut(s) 46
LpnPI CCDG 5 cut(s) 36, 63, 66, 71, 81
MluCI AATT 1 cut(s) 89
MmeI TCCRAC 1 cut(s) 31
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PstNI CAGNNNCTG 1 cut(s) 50
ScrFI CCNGG 1 cut(s) 51
SetI ASST 2 cut(s) 66, 100
SgeI CNNG 6 cut(s) 38, 62, 63, 93, 98, 108
Sse9I AATT 1 cut(s) 89
StyD4I CCNGG 1 cut(s) 49
TaaI ACNGT 1 cut(s) 46
TasI AATT 1 cut(s) 89
XmiI GTMKAC 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.