Rh3BG342200

This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
36772240 .. 36779086
6847 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG342200.1

Sequence Viewer

Length: 237 bp
ATGTTCCAGCTTTTGTGGTCTGTACTTGGTCGTCATTGGTATACAGTCCCTGGTGAAAGCAAGGTTTATGTTGGTAAAACTGGGCAGGAATTGACAGGTCAAACAGCCCACAGACTATGCTCAAAGGCCGACATTGGTCTTGCTATGGGTATTCAAGGTTCTGAGGTTGCCAAAGAGAGTTCTGAAATCATTATCTTGGATGACAATTATGCTTCAGTTGTGAAGGAAAATAGTTGA

Protein Analysis

78

Amino Acids

8.54

Weight (kDa)

5.53

Isoelectric Point (pI)

28.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 41
AcuI CTGAAG 1 cut(s) 198
AfaI GTAC 1 cut(s) 24
AgsI TTSAA 1 cut(s) 155
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
AlwNI CAGNNNCTG 1 cut(s) 50
AoxI GGCC 1 cut(s) 126
AsuHPI GGTGA 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 51
Bme1390I CCNGG 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 51
BmrI ACTGGG 1 cut(s) 90
BmuI ACTGGG 1 cut(s) 90
BoxI GACNNNNGTC 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 49
Bse1I ACTGG 1 cut(s) 85
BseBI CCWGG 1 cut(s) 51
BseDI CCNNGG 1 cut(s) 49
BseGI GGATG 1 cut(s) 205
BseMII CTCAG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 85
BshFI GGCC 1 cut(s) 128
BslFI GGGAC 1 cut(s) 32
BsmFI GGGAC 1 cut(s) 32
BsnI GGCC 1 cut(s) 128
BspANI GGCC 1 cut(s) 128
BspCNI CTCAG 1 cut(s) 154
BsrI ACTGG 1 cut(s) 85
BssECI CCNNGG 1 cut(s) 49
BssNAI GTATAC 1 cut(s) 42
Bst1107I GTATAC 1 cut(s) 42
Bst2UI CCWGG 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 46
BstDEI CTNAG 1 cut(s) 162
BstF5I GGATG 1 cut(s) 205
BstNI CCWGG 1 cut(s) 51
BstPAI GACNNNNGTC 1 cut(s) 135
BstSCI CCNGG 1 cut(s) 49
BstZ17I GTATAC 1 cut(s) 42
BsuRI GGCC 1 cut(s) 128
BtsCI GGATG 1 cut(s) 205
CaiI CAGNNNCTG 1 cut(s) 50
Csp6I GTAC 1 cut(s) 23
CviJI RGCY 3 cut(s) 10, 107, 128
CviKI_1 RGCY 3 cut(s) 10, 107, 128
CviQI GTAC 1 cut(s) 23
DdeI CTNAG 1 cut(s) 162
Eco57I CTGAAG 1 cut(s) 198
EcoRII CCWGG 1 cut(s) 49
FaiI YATR 5 cut(s) 42, 69, 118, 146, 210
FaqI GGGAC 1 cut(s) 32
FblI GTMKAC 1 cut(s) 41
FokI GGATG 1 cut(s) 212
HaeIII GGCC 1 cut(s) 128
HphI GGTGA 1 cut(s) 65
Hpy166II GTNNAC 1 cut(s) 42
Hpy188I TCNGA 2 cut(s) 163, 184
Hpy8I GTNNAC 1 cut(s) 42
HpyAV CCTTC 1 cut(s) 217
HpyCH4III ACNGT 1 cut(s) 46
HpyF3I CTNAG 1 cut(s) 162
LpnPI CCDG 6 cut(s) 20, 36, 63, 66, 71, 81
MluCI AATT 2 cut(s) 89, 205
MnlI CCTC 1 cut(s) 157
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
PshAI GACNNNNGTC 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PsrI GAACNNNNNNTAC 2 cut(s) 142, 174
PstNI CAGNNNCTG 1 cut(s) 50
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
ScrFI CCNGG 1 cut(s) 51
SetI ASST 5 cut(s) 12, 66, 100, 160, 168
Sse9I AATT 2 cut(s) 89, 205
StyD4I CCNGG 1 cut(s) 49
TaaI ACNGT 1 cut(s) 46
TasI AATT 2 cut(s) 89, 205
TatI WGTACW 1 cut(s) 22
XmiI GTMKAC 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.