RchiOBHm_Chr1g0336251

V-type proton ATPase catalytic subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
27907175 .. 27909364
2190 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGCATTTACTCTGTATCTTTTCTTTGATCCATATCTACTTTTCATTTTGGTTGGGACTGGTAGTCACTAATGATCATTTTCCTGTTGTAAGGGTGGACAGATATGATAAATTCTGCCCTTTCTACAAGTCTGTTTGGATGATGCGGAATATCATCCATTTCTTTAATTTAGCAAATCAGGAACCAATATTCGATTAA
Functional Annotation

Protein Analysis

65

Amino Acids

7.99

Weight (kDa)

6.89

Isoelectric Point (pI)

56.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 145
AclWI GGATC 1 cut(s) 22
AcsI RAATTY 1 cut(s) 110
AhdI GACNNNNNGTC 1 cut(s) 62
AlwI GGATC 1 cut(s) 22
ApoI RAATTY 1 cut(s) 110
BclI TGATCA 1 cut(s) 73
BmeRI GACNNNNNGTC 1 cut(s) 62
BmiI GGNNCC 1 cut(s) 183
BmsI GCATC 1 cut(s) 132
BsaBI GATNNNNATC 1 cut(s) 32
Bse1I ACTGG 1 cut(s) 63
Bse8I GATNNNNATC 1 cut(s) 32
BseGI GGATG 2 cut(s) 144, 153
BseJI GATNNNNATC 1 cut(s) 32
BseNI ACTGG 1 cut(s) 63
BslFI GGGAC 1 cut(s) 69
BsmFI GGGAC 1 cut(s) 69
Bsp143I GATC 2 cut(s) 27, 73
BspACI CCGC 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 183
BspPI GGATC 1 cut(s) 22
BsrI ACTGG 1 cut(s) 63
BssMI GATC 2 cut(s) 27, 73
BstF5I GGATG 2 cut(s) 144, 153
BstKTI GATC 2 cut(s) 30, 76
BstMBI GATC 2 cut(s) 27, 73
BtsCI GGATG 2 cut(s) 144, 153
DpnI GATC 2 cut(s) 29, 75
DpnII GATC 2 cut(s) 27, 73
DriI GACNNNNNGTC 1 cut(s) 62
Eam1105I GACNNNNNGTC 1 cut(s) 62
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 2 cut(s) 33, 105
FaqI GGGAC 1 cut(s) 69
FbaI TGATCA 1 cut(s) 73
FokI GGATG 2 cut(s) 140, 151
Hpy166II GTNNAC 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 97
HpyCH4V TGCA 1 cut(s) 4
Ksp22I TGATCA 1 cut(s) 73
Kzo9I GATC 2 cut(s) 27, 73
LpnPI CCDG 3 cut(s) 44, 96, 164
LweI GCATC 1 cut(s) 132
MaeIII GTNAC 1 cut(s) 64
MalI GATC 2 cut(s) 29, 75
MboI GATC 2 cut(s) 27, 73
MluCI AATT 2 cut(s) 110, 166
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 165, 196
NdeII GATC 2 cut(s) 27, 73
NlaIV GGNNCC 1 cut(s) 183
NmuCI GTSAC 1 cut(s) 64
NsiI ATGCAT 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 183
SaqAI TTAA 2 cut(s) 165, 196
Sau3AI GATC 2 cut(s) 27, 73
SfaNI GCATC 1 cut(s) 132
SgeI CNNG 4 cut(s) 71, 95, 139, 191
Sse9I AATT 2 cut(s) 110, 166
SsiI CCGC 1 cut(s) 145
SspI AATATT 1 cut(s) 189
TaqI TCGA 1 cut(s) 192
TasI AATT 2 cut(s) 110, 166
Tru1I TTAA 2 cut(s) 165, 196
Tru9I TTAA 2 cut(s) 165, 196
TseFI GTSAC 1 cut(s) 64
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 1 cut(s) 33
XapI RAATTY 1 cut(s) 110
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.