RchiOBHm_Chr1g0380361

Ribosomal protein S1-like RNA-binding domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
66062057 .. 66062284
228 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 228 bp
ATGTCATATGACGATTGCATCAAACAGCGGATGGAAAGAGAAGCCAAGGGAATAAAACCAAGAGAATATGACGAGGAAGATACAAACATAGATGATGATGATGAAGACGATGACGATGATGACTTTGATTTCAGCTTCTTGAATGAAACCGTTGATATGACCACGCAGCCCCATGTTAATGGGACAGAATCTCCTGGAATTTCTGATGAGGGCATGTTTGAGGATTAA

Protein Analysis

75

Amino Acids

8.72

Weight (kDa)

4.05

Isoelectric Point (pI)

38.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021290)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 28
AcsI RAATTY 1 cut(s) 198
AgsI TTSAA 1 cut(s) 142
AjnI CCWGG 1 cut(s) 193
AluBI AGCT 1 cut(s) 135
AluI AGCT 1 cut(s) 135
ApeKI GCWGC 1 cut(s) 166
ApoI RAATTY 1 cut(s) 198
BbsI GAAGAC 1 cut(s) 111
BbvI GCAGC 1 cut(s) 178
BccI CCATC 1 cut(s) 25
BciT130I CCWGG 1 cut(s) 195
BisI GCNGC 1 cut(s) 167
BlsI GCNGC 1 cut(s) 168
Bme1390I CCNGG 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 195
BmsI GCATC 1 cut(s) 27
BpiI GAAGAC 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 45
BsaXI ACNNNNNCTCC 2 cut(s) 175, 205
BseBI CCWGG 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 45
BseGI GGATG 1 cut(s) 36
BseXI GCAGC 1 cut(s) 178
BslFI GGGAC 1 cut(s) 196
BsmFI GGGAC 1 cut(s) 196
BspACI CCGC 1 cut(s) 28
BssECI CCNNGG 1 cut(s) 45
BssT1I CCWWGG 1 cut(s) 45
Bst2UI CCWGG 1 cut(s) 195
Bst4CI ACNGT 1 cut(s) 151
BstF5I GGATG 1 cut(s) 36
BstNI CCWGG 1 cut(s) 195
BstNSI RCATGY 1 cut(s) 217
BstSCI CCNGG 1 cut(s) 193
BstV1I GCAGC 1 cut(s) 178
BstV2I GAAGAC 1 cut(s) 111
BstXI CCANNNNNNTGG 1 cut(s) 179
BtsCI GGATG 1 cut(s) 36
CviAII CATG 2 cut(s) 173, 214
CviJI RGCY 3 cut(s) 44, 135, 169
CviKI_1 RGCY 3 cut(s) 44, 135, 169
Eco130I CCWWGG 1 cut(s) 45
EcoRII CCWGG 1 cut(s) 193
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaeI CATG 2 cut(s) 176, 217
FaiI YATR 7 cut(s) 7, 9, 69, 89, 158, 174, 215
FaqI GGGAC 1 cut(s) 196
FatI CATG 2 cut(s) 172, 213
FauNDI CATATG 1 cut(s) 7
Fnu4HI GCNGC 1 cut(s) 167
FokI GGATG 1 cut(s) 43
Fsp4HI GCNGC 1 cut(s) 167
GluI GCNGC 1 cut(s) 167
Hin1II CATG 2 cut(s) 176, 217
HinfI GANTC 1 cut(s) 188
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 139
HpyCH4III ACNGT 1 cut(s) 151
HpyCH4V TGCA 1 cut(s) 18
Hsp92II CATG 2 cut(s) 176, 217
LpnPI CCDG 2 cut(s) 180, 207
Lsp1109I GCAGC 1 cut(s) 178
LweI GCATC 1 cut(s) 27
MboII GAAGA 2 cut(s) 89, 116
MluCI AATT 1 cut(s) 198
MnlI CCTC 3 cut(s) 67, 202, 214
MseI TTAA 2 cut(s) 177, 226
MslI CAYNNNNRTG 1 cut(s) 177
MspA1I CMGCKG 1 cut(s) 28
MspR9I CCNGG 1 cut(s) 195
MvaI CCWGG 1 cut(s) 195
NdeI CATATG 1 cut(s) 7
NlaIII CATG 2 cut(s) 176, 217
NspI RCATGY 1 cut(s) 217
PfeI GAWTC 1 cut(s) 188
PfoI TCCNGGA 1 cut(s) 193
PkrI GCNGC 1 cut(s) 168
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
RseI CAYNNNNRTG 1 cut(s) 177
SaqAI TTAA 2 cut(s) 177, 226
SatI GCNGC 1 cut(s) 167
ScrFI CCNGG 1 cut(s) 195
SetI ASST 1 cut(s) 137
SfaNI GCATC 1 cut(s) 27
SgeI CNNG 8 cut(s) 58, 72, 85, 151, 175, 185, 206, 207
SmiMI CAYNNNNRTG 1 cut(s) 177
Sse9I AATT 1 cut(s) 198
SsiI CCGC 1 cut(s) 28
StyD4I CCNGG 1 cut(s) 193
StyI CCWWGG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 151
TasI AATT 1 cut(s) 198
TfiI GAWTC 1 cut(s) 188
Tru1I TTAA 2 cut(s) 177, 226
Tru9I TTAA 2 cut(s) 177, 226
TseI GCWGC 1 cut(s) 166
TspDTI ATGAA 2 cut(s) 117, 159
XapI RAATTY 1 cut(s) 198
XceI RCATGY 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.