RCHIOBHM_CHR0C11G0499491

U3 small nucleolar RNA-associated protein 6 homolog

Basic Information

Type: Sequence Only
Biological Identity
rosa_chinensis
Unknown
Physical Location & Seq
Reverse (-)
0 .. 0
1 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGAGAAAGGGACAAGTGTTCTGCTTCTGTTTTGTGGCAGTCCATCTAAGCTTTATTGCTATACCACACCCTGGCTTTGCTCCATATAGGCCCTGCATTGTGTTGGAATCAAACCTCGCATCCAGTCTTGTAAATGCCAGGAAGTTATATTATTCTGCACTTAAAAGCTTATAA

Protein Analysis

57

Amino Acids

6.38

Weight (kDa)

9.57

Isoelectric Point (pI)

11.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021291)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 172
AccB7I CCANNNNNTGG 1 cut(s) 71
AfiI CCNNNNNNNGG 1 cut(s) 71
AjnI CCWGG 2 cut(s) 70, 137
AluBI AGCT 2 cut(s) 51, 168
AluI AGCT 2 cut(s) 51, 168
AoxI GGCC 1 cut(s) 89
AspS9I GGNCC 1 cut(s) 90
BccI CCATC 1 cut(s) 51
BciT130I CCWGG 2 cut(s) 72, 139
Bme1390I CCNGG 2 cut(s) 72, 139
BmgT120I GGNCC 1 cut(s) 90
BmrFI CCNGG 2 cut(s) 72, 139
BmsI GCATC 1 cut(s) 128
BsaJI CCNNGG 1 cut(s) 70
Bsc4I CCNNNNNNNGG 1 cut(s) 71
Bse1I ACTGG 1 cut(s) 123
BseBI CCWGG 2 cut(s) 72, 139
BseDI CCNNGG 1 cut(s) 70
BseGI GGATG 1 cut(s) 119
BseLI CCNNNNNNNGG 1 cut(s) 71
BseNI ACTGG 1 cut(s) 123
BsgI GTGCAG 1 cut(s) 141
BshFI GGCC 1 cut(s) 91
BslFI GGGAC 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 71
BsmFI GGGAC 1 cut(s) 24
BsnI GGCC 1 cut(s) 91
BspANI GGCC 1 cut(s) 91
BsrI ACTGG 1 cut(s) 123
BssECI CCNNGG 1 cut(s) 70
Bst2UI CCWGG 2 cut(s) 72, 139
BstDEI CTNAG 1 cut(s) 47
BstF5I GGATG 1 cut(s) 119
BstNI CCWGG 2 cut(s) 72, 139
BstSCI CCNGG 2 cut(s) 70, 137
BsuRI GGCC 1 cut(s) 91
BtsCI GGATG 1 cut(s) 119
Cfr13I GGNCC 1 cut(s) 90
CviJI RGCY 4 cut(s) 51, 75, 91, 168
CviKI_1 RGCY 4 cut(s) 51, 75, 91, 168
DdeI CTNAG 1 cut(s) 47
EcoO109I RGGNCCY 1 cut(s) 90
EcoRII CCWGG 2 cut(s) 70, 137
FaiI YATR 5 cut(s) 62, 85, 87, 148, 172
FaqI GGGAC 1 cut(s) 24
FokI GGATG 1 cut(s) 106
HaeIII GGCC 1 cut(s) 91
HindIII AAGCTT 2 cut(s) 49, 166
HinfI GANTC 1 cut(s) 107
HpyCH4V TGCA 2 cut(s) 96, 158
HpyF3I CTNAG 1 cut(s) 47
LmnI GCTCC 1 cut(s) 85
LpnPI CCDG 6 cut(s) 57, 84, 106, 124, 136, 151
LweI GCATC 1 cut(s) 128
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 1 cut(s) 125
MseI TTAA 1 cut(s) 162
MspR9I CCNGG 2 cut(s) 72, 139
MvaI CCWGG 2 cut(s) 72, 139
PfeI GAWTC 1 cut(s) 107
PflMI CCANNNNNTGG 1 cut(s) 71
PsiI TTATAA 1 cut(s) 172
Psp6I CCWGG 2 cut(s) 70, 137
PspGI CCWGG 2 cut(s) 70, 137
PspPI GGNCC 1 cut(s) 90
SaqAI TTAA 1 cut(s) 162
Sau96I GGNCC 1 cut(s) 90
ScrFI CCNGG 2 cut(s) 72, 139
SetI ASST 3 cut(s) 53, 117, 170
SfaNI GCATC 1 cut(s) 128
SgeI CNNG 9 cut(s) 26, 83, 84, 105, 128, 135, 140, 150, 151
StyD4I CCNGG 2 cut(s) 70, 137
TfiI GAWTC 1 cut(s) 107
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
Van91I CCANNNNNTGG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.