RchiOBHm_Chr1g0317781

Exosome complex component

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
5334133 .. 5335669
1537 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54807

Sequence Viewer

Length: 171 bp
ATGGTGCCTAGTCTTGGAAAGAACCTAGTGATTGATCCTGTTTTGGAGGAAGAAAGTTACCAAGATGGAAGCTTAAAGCTTACTTGCAGGCCTTCTCGCTATGAAGTCACTCAGCTAACTATGTCAGGGGAATGGTCAACCCCAAAATTAATGAGGTATGCAGTCGGCTGA

Protein Analysis

56

Amino Acids

6.31

Weight (kDa)

5.14

Isoelectric Point (pI)

41.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020471)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AclWI GGATC 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 14
AluBI AGCT 3 cut(s) 72, 79, 115
AluI AGCT 3 cut(s) 72, 79, 115
AlwI GGATC 1 cut(s) 29
AoxI GGCC 1 cut(s) 89
AseI ATTAAT 1 cut(s) 149
BanI GGYRCC 1 cut(s) 4
BccI CCATC 1 cut(s) 59
BfaI CTAG 2 cut(s) 9, 26
BmiI GGNNCC 1 cut(s) 6
Bsc4I CCNNNNNNNGG 1 cut(s) 14
BseLI CCNNNNNNNGG 1 cut(s) 14
BseMII CTCAG 1 cut(s) 125
BshFI GGCC 1 cut(s) 91
BshNI GGYRCC 1 cut(s) 4
BslI CCNNNNNNNGG 1 cut(s) 14
BsnI GGCC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 34
BspANI GGCC 1 cut(s) 91
BspCNI CTCAG 1 cut(s) 124
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 29
BspT107I GGYRCC 1 cut(s) 4
BssMI GATC 1 cut(s) 34
BstC8I GCNNGC 1 cut(s) 89
BstDEI CTNAG 1 cut(s) 111
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BsuRI GGCC 1 cut(s) 91
Cac8I GCNNGC 1 cut(s) 89
CviJI RGCY 5 cut(s) 72, 79, 91, 115, 168
CviKI_1 RGCY 5 cut(s) 72, 79, 91, 115, 168
DdeI CTNAG 1 cut(s) 111
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eco147I AGGCCT 1 cut(s) 91
FaiI YATR 3 cut(s) 102, 122, 159
FspBI CTAG 2 cut(s) 9, 26
HaeIII GGCC 1 cut(s) 91
HincII GTYRAC 1 cut(s) 138
HindII GTYRAC 1 cut(s) 138
HindIII AAGCTT 2 cut(s) 70, 77
Hpy166II GTNNAC 1 cut(s) 138
Hpy8I GTNNAC 1 cut(s) 138
HpyAV CCTTC 1 cut(s) 102
HpyCH4V TGCA 2 cut(s) 87, 161
HpyF3I CTNAG 1 cut(s) 111
Kzo9I GATC 1 cut(s) 34
LpnPI CCDG 3 cut(s) 51, 73, 111
MaeI CTAG 2 cut(s) 9, 26
MaeIII GTNAC 2 cut(s) 56, 106
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 1 cut(s) 62
MluCI AATT 1 cut(s) 146
MnlI CCTC 2 cut(s) 40, 147
MseI TTAA 2 cut(s) 74, 149
NdeII GATC 1 cut(s) 34
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 106
PceI AGGCCT 1 cut(s) 91
PshBI ATTAAT 1 cut(s) 149
PspN4I GGNNCC 1 cut(s) 6
SaqAI TTAA 2 cut(s) 74, 149
Sau3AI GATC 1 cut(s) 34
SetI ASST 5 cut(s) 27, 74, 81, 117, 158
SgeI CNNG 9 cut(s) 21, 26, 38, 50, 74, 96, 100, 108, 138
Sse9I AATT 1 cut(s) 146
SseBI AGGCCT 1 cut(s) 91
SspMI CTAG 2 cut(s) 9, 26
StuI AGGCCT 1 cut(s) 91
TasI AATT 1 cut(s) 146
Tru1I TTAA 2 cut(s) 74, 149
Tru9I TTAA 2 cut(s) 74, 149
TseFI GTSAC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 106
TspDTI ATGAA 1 cut(s) 117
VspI ATTAAT 1 cut(s) 149
XspI CTAG 2 cut(s) 9, 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.