Rh2AG551600

Exosome complex component

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
78185971 .. 78187838
1868 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG551600.1

Sequence Viewer

Length: 240 bp
ATGGTGCCTAGTCTTGGAAAGAACCTAGTGATTGATCCTGTTTTGGGGGAAGAAAGCTACCAAGATGGAAGCTTAAAGCTTACTTGCAGGCCTTCTCGCTATGAAGTCACTCAGCTAACTATGTCAGGGGAATGGTCAACCCCAAAAATTTATATTTCAAAGGTGAACTGGTCCATCAGATCTTGCAACTCTTCTACAGATACAGTTGCTTGCTCACTCTACCCTGCTGTGGTTGCTTAA

Protein Analysis

79

Amino Acids

8.67

Weight (kDa)

6.1

Isoelectric Point (pI)

44.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020471)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AclWI GGATC 1 cut(s) 29
AcsI RAATTY 1 cut(s) 147
AfiI CCNNNNNNNGG 3 cut(s) 14, 44, 229
AgsI TTSAA 1 cut(s) 159
AluBI AGCT 4 cut(s) 57, 72, 79, 115
AluI AGCT 4 cut(s) 57, 72, 79, 115
AlwI GGATC 1 cut(s) 29
AoxI GGCC 1 cut(s) 89
ApoI RAATTY 1 cut(s) 147
AspS9I GGNCC 1 cut(s) 171
AsuHPI GGTGA 1 cut(s) 175
AvaII GGWCC 1 cut(s) 171
BanI GGYRCC 1 cut(s) 4
BccI CCATC 2 cut(s) 59, 182
BfaI CTAG 2 cut(s) 9, 26
BfmI CTRYAG 1 cut(s) 195
BglII AGATCT 1 cut(s) 179
Bme18I GGWCC 1 cut(s) 171
BmgT120I GGNCC 1 cut(s) 171
BmiI GGNNCC 1 cut(s) 6
Bsc4I CCNNNNNNNGG 3 cut(s) 14, 44, 229
Bse1I ACTGG 1 cut(s) 173
BseLI CCNNNNNNNGG 3 cut(s) 14, 44, 229
BseMII CTCAG 1 cut(s) 125
BseNI ACTGG 1 cut(s) 173
BshFI GGCC 1 cut(s) 91
BshNI GGYRCC 1 cut(s) 4
BslI CCNNNNNNNGG 3 cut(s) 14, 44, 229
BsnI GGCC 1 cut(s) 91
Bsp143I GATC 2 cut(s) 34, 179
BspANI GGCC 1 cut(s) 91
BspCNI CTCAG 1 cut(s) 124
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 29
BspT107I GGYRCC 1 cut(s) 4
BsrI ACTGG 1 cut(s) 173
BssMI GATC 2 cut(s) 34, 179
Bst4CI ACNGT 1 cut(s) 205
Bst6I CTCTTC 1 cut(s) 196
BstC8I GCNNGC 2 cut(s) 89, 211
BstDEI CTNAG 1 cut(s) 111
BstKTI GATC 2 cut(s) 37, 182
BstMBI GATC 2 cut(s) 34, 179
BstMWI GCNNNNNNNGC 1 cut(s) 233
BstSFI CTRYAG 1 cut(s) 195
BstX2I RGATCY 1 cut(s) 179
BstYI RGATCY 1 cut(s) 179
BsuRI GGCC 1 cut(s) 91
Cac8I GCNNGC 2 cut(s) 89, 211
Cfr13I GGNCC 1 cut(s) 171
CviJI RGCY 5 cut(s) 57, 72, 79, 91, 115
CviKI_1 RGCY 5 cut(s) 57, 72, 79, 91, 115
DdeI CTNAG 1 cut(s) 111
DpnI GATC 2 cut(s) 36, 181
DpnII GATC 2 cut(s) 34, 179
Eam1104I CTCTTC 1 cut(s) 196
EarI CTCTTC 1 cut(s) 196
Eco147I AGGCCT 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 171
FaiI YATR 3 cut(s) 102, 122, 153
FspBI CTAG 2 cut(s) 9, 26
HaeIII GGCC 1 cut(s) 91
HincII GTYRAC 1 cut(s) 138
HindII GTYRAC 1 cut(s) 138
HindIII AAGCTT 2 cut(s) 70, 77
HphI GGTGA 1 cut(s) 175
Hpy166II GTNNAC 2 cut(s) 138, 166
Hpy188I TCNGA 1 cut(s) 179
Hpy8I GTNNAC 2 cut(s) 138, 166
HpyAV CCTTC 1 cut(s) 102
HpyCH4III ACNGT 1 cut(s) 205
HpyCH4V TGCA 2 cut(s) 87, 186
HpyF10VI GCNNNNNNNGC 1 cut(s) 233
HpyF3I CTNAG 1 cut(s) 111
Kzo9I GATC 2 cut(s) 34, 179
LpnPI CCDG 4 cut(s) 51, 73, 111, 154
MaeI CTAG 2 cut(s) 9, 26
MaeIII GTNAC 1 cut(s) 106
MalI GATC 2 cut(s) 36, 181
MboI GATC 2 cut(s) 34, 179
MboII GAAGA 2 cut(s) 62, 183
MflI RGATCY 1 cut(s) 179
MluCI AATT 1 cut(s) 147
MseI TTAA 2 cut(s) 74, 238
MwoI GCNNNNNNNGC 1 cut(s) 233
NdeII GATC 2 cut(s) 34, 179
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 106
PceI AGGCCT 1 cut(s) 91
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 171
PsuI RGATCY 1 cut(s) 179
SaqAI TTAA 2 cut(s) 74, 238
Sau3AI GATC 2 cut(s) 34, 179
Sau96I GGNCC 1 cut(s) 171
SetI ASST 6 cut(s) 27, 59, 74, 81, 117, 165
SfcI CTRYAG 1 cut(s) 195
SinI GGWCC 1 cut(s) 171
Sse9I AATT 1 cut(s) 147
SseBI AGGCCT 1 cut(s) 91
SspMI CTAG 2 cut(s) 9, 26
StuI AGGCCT 1 cut(s) 91
TaaI ACNGT 1 cut(s) 205
TasI AATT 1 cut(s) 147
Tru1I TTAA 2 cut(s) 74, 238
Tru9I TTAA 2 cut(s) 74, 238
TseFI GTSAC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 106
TspDTI ATGAA 1 cut(s) 117
VpaK11BI GGWCC 1 cut(s) 171
XapI RAATTY 1 cut(s) 147
XspI CTAG 2 cut(s) 9, 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.