RchiOBHm_Chr2g0135441

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
52480311 .. 52480834
524 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50634

Sequence Viewer

Length: 216 bp
ATGAACTTGAAGATGTTGATGATGAGGATGAATTTCGCATTGGAGATTGGGAAGAAGATGGAGAACAGAGTCCACAAACAACTAAATATTACATCCACATATGGTGGCATATCATCATCATCAAGTACATACTGCTACGTAGCAAAATTTATTCTATGTACAAAAATTCATGTAATGGTGACAGAAACTTTTGTAGGTGAGTATTTGATTGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.12

Weight (kDa)

9.3

Isoelectric Point (pI)

47.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021331)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 31, 146, 165
AfaI GTAC 2 cut(s) 127, 160
AgsI TTSAA 1 cut(s) 10
AjuI GAANNNNNNNTTGG 2 cut(s) 23, 55
ApoI RAATTY 3 cut(s) 31, 146, 165
AsuHPI GGTGA 2 cut(s) 190, 209
BccI CCATC 1 cut(s) 52
BsaAI YACGTR 1 cut(s) 139
BseGI GGATG 2 cut(s) 33, 92
Bsp1407I TGTACA 1 cut(s) 158
BsrGI TGTACA 1 cut(s) 158
BstAUI TGTACA 1 cut(s) 158
BstBAI YACGTR 1 cut(s) 139
BstF5I GGATG 2 cut(s) 33, 92
BstSNI TACGTA 1 cut(s) 139
BtsCI GGATG 2 cut(s) 33, 92
Csp6I GTAC 2 cut(s) 126, 159
CviAII CATG 1 cut(s) 170
CviQI GTAC 2 cut(s) 126, 159
Eco105I TACGTA 1 cut(s) 139
FaeI CATG 1 cut(s) 173
FaiI YATR 7 cut(s) 100, 102, 110, 130, 157, 171, 214
FatI CATG 1 cut(s) 169
FauNDI CATATG 1 cut(s) 100
FokI GGATG 2 cut(s) 40, 79
Hin1II CATG 1 cut(s) 173
HinfI GANTC 1 cut(s) 69
HphI GGTGA 2 cut(s) 190, 209
Hpy166II GTNNAC 1 cut(s) 73
Hpy8I GTNNAC 1 cut(s) 73
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 212
HpySE526I ACGT 1 cut(s) 138
Hsp92II CATG 1 cut(s) 173
MaeII ACGT 1 cut(s) 138
MaeIII GTNAC 1 cut(s) 178
MboII GAAGA 3 cut(s) 22, 64, 67
MluCI AATT 3 cut(s) 31, 146, 165
MlyI GAGTC 1 cut(s) 78
MnlI CCTC 1 cut(s) 18
NdeI CATATG 1 cut(s) 100
NlaIII CATG 1 cut(s) 173
NmuCI GTSAC 1 cut(s) 178
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
Ppu21I YACGTR 1 cut(s) 139
RsaI GTAC 2 cut(s) 127, 160
RsaNI GTAC 2 cut(s) 126, 159
SchI GAGTC 1 cut(s) 78
SetI ASST 2 cut(s) 141, 199
SgeI CNNG 3 cut(s) 19, 135, 182
SnaBI TACGTA 1 cut(s) 139
Sse9I AATT 3 cut(s) 31, 146, 165
SspI AATATT 1 cut(s) 88
TaiI ACGT 1 cut(s) 141
TasI AATT 3 cut(s) 31, 146, 165
TatI WGTACW 2 cut(s) 125, 158
TseFI GTSAC 1 cut(s) 178
Tsp45I GTSAC 1 cut(s) 178
TspDTI ATGAA 3 cut(s) 17, 44, 158
XapI RAATTY 3 cut(s) 31, 146, 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.