RchiOBHm_Chr2g0143811

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
61439788 .. 61440391
604 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51388

Sequence Viewer

Length: 147 bp
ATGAACTTGAACATGTTTATGAAGAGGATGAATTTCGCATTGGAGATTGGGAAGAAGATGGAGAACAGAGTCCACAAACAACGAAATATTACATCCACATATGGTGGCATATCATCATCATCAAGTACATACTGCTACAAACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

48

Amino Acids

5.61

Weight (kDa)

10.01

Isoelectric Point (pI)

57.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021331)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 31
AfaI GTAC 1 cut(s) 127
AflIII ACRYGT 1 cut(s) 12
AgsI TTSAA 1 cut(s) 10
AjuI GAANNNNNNNTTGG 2 cut(s) 23, 55
ApoI RAATTY 1 cut(s) 31
BccI CCATC 1 cut(s) 52
BseGI GGATG 2 cut(s) 33, 92
Bst6I CTCTTC 1 cut(s) 17
BstF5I GGATG 2 cut(s) 33, 92
BstNSI RCATGY 1 cut(s) 16
BtsCI GGATG 2 cut(s) 33, 92
Csp6I GTAC 1 cut(s) 126
CviAII CATG 1 cut(s) 13
CviQI GTAC 1 cut(s) 126
Eam1104I CTCTTC 1 cut(s) 17
EarI CTCTTC 1 cut(s) 17
FaeI CATG 1 cut(s) 16
FaiI YATR 6 cut(s) 14, 20, 100, 102, 110, 130
FatI CATG 1 cut(s) 12
FauNDI CATATG 1 cut(s) 100
FokI GGATG 2 cut(s) 40, 79
FspEI CC 9 cut(s) 10, 26, 33, 34, 44, 86, 87, 90, 109
Hin1II CATG 1 cut(s) 16
HinfI GANTC 1 cut(s) 69
Hpy166II GTNNAC 1 cut(s) 73
Hpy8I GTNNAC 1 cut(s) 73
Hsp92II CATG 1 cut(s) 16
MboII GAAGA 3 cut(s) 34, 64, 67
MluCI AATT 1 cut(s) 31
MlyI GAGTC 1 cut(s) 78
MnlI CCTC 1 cut(s) 18
MslI CAYNNNNRTG 1 cut(s) 17
NdeI CATATG 1 cut(s) 100
NlaIII CATG 1 cut(s) 16
NspI RCATGY 1 cut(s) 16
PciI ACATGT 1 cut(s) 12
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
PscI ACATGT 1 cut(s) 12
RsaI GTAC 1 cut(s) 127
RsaNI GTAC 1 cut(s) 126
RseI CAYNNNNRTG 1 cut(s) 17
SchI GAGTC 1 cut(s) 78
SgeI CNNG 3 cut(s) 19, 25, 135
SmiMI CAYNNNNRTG 1 cut(s) 17
Sse9I AATT 1 cut(s) 31
SspI AATATT 1 cut(s) 88
TasI AATT 1 cut(s) 31
TatI WGTACW 1 cut(s) 125
TspDTI ATGAA 3 cut(s) 17, 35, 44
XapI RAATTY 1 cut(s) 31
XceI RCATGY 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.