RchiOBHm_Chr2g0144951

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
62512995 .. 62513779
785 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51482

Sequence Viewer

Length: 159 bp
ATGGAGAACAGAGTCCACAAACAACTAAATATTACATCCACATATGGTGGCATATCATCATCATCAAGTACATACTGCTACGTAGCAAAATTTATTCTATGTACAAAAATTCATGTAATGGTGACAGAAACTTTTGTAGGTGAGTATTTGACTGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.82

Weight (kDa)

7.81

Isoelectric Point (pI)

53.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021331)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 89, 108
AfaI GTAC 2 cut(s) 70, 103
ApoI RAATTY 2 cut(s) 89, 108
AsuHPI GGTGA 2 cut(s) 133, 152
BsaAI YACGTR 1 cut(s) 82
BseGI GGATG 1 cut(s) 35
Bsp1407I TGTACA 1 cut(s) 101
BsrGI TGTACA 1 cut(s) 101
BstAUI TGTACA 1 cut(s) 101
BstBAI YACGTR 1 cut(s) 82
BstF5I GGATG 1 cut(s) 35
BstSNI TACGTA 1 cut(s) 82
BtsCI GGATG 1 cut(s) 35
Csp6I GTAC 2 cut(s) 69, 102
CviAII CATG 1 cut(s) 113
CviQI GTAC 2 cut(s) 69, 102
Eco105I TACGTA 1 cut(s) 82
FaeI CATG 1 cut(s) 116
FaiI YATR 7 cut(s) 43, 45, 53, 73, 100, 114, 157
FatI CATG 1 cut(s) 112
FauNDI CATATG 1 cut(s) 43
FokI GGATG 1 cut(s) 22
FspEI CC 6 cut(s) 29, 30, 33, 52, 104, 123
Hin1II CATG 1 cut(s) 116
HinfI GANTC 1 cut(s) 12
HphI GGTGA 2 cut(s) 133, 152
Hpy166II GTNNAC 1 cut(s) 16
Hpy8I GTNNAC 1 cut(s) 16
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 1 cut(s) 155
HpySE526I ACGT 1 cut(s) 81
Hsp92II CATG 1 cut(s) 116
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 121
MluCI AATT 2 cut(s) 89, 108
MlyI GAGTC 1 cut(s) 21
NdeI CATATG 1 cut(s) 43
NlaIII CATG 1 cut(s) 116
NmuCI GTSAC 1 cut(s) 121
PleI GAGTC 1 cut(s) 20
PpsI GAGTC 1 cut(s) 20
Ppu21I YACGTR 1 cut(s) 82
RsaI GTAC 2 cut(s) 70, 103
RsaNI GTAC 2 cut(s) 69, 102
SchI GAGTC 1 cut(s) 21
SetI ASST 2 cut(s) 84, 142
SgeI CNNG 2 cut(s) 78, 125
SnaBI TACGTA 1 cut(s) 82
Sse9I AATT 2 cut(s) 89, 108
SspI AATATT 1 cut(s) 31
TaiI ACGT 1 cut(s) 84
TasI AATT 2 cut(s) 89, 108
TatI WGTACW 2 cut(s) 68, 101
TseFI GTSAC 1 cut(s) 121
Tsp45I GTSAC 1 cut(s) 121
TspDTI ATGAA 1 cut(s) 101
XapI RAATTY 2 cut(s) 89, 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.