Rh2DG462900
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
66815023 .. 66815675
653 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG462900.1

Sequence Viewer

Length: 225 bp
ATGTTTATGAAGAGGATGAATTTCGCATTGGAGATTGGGAAGAAGATGGAGAACAGAGTCCACAAACAACTAAATATTACATCCACATATGGTGGCATATCATCATCATCAACTGGAATTCCAAATGTGCGATGGTTTGGCACCGAAGGAGACTACAATGTTCTTGTGATGGATTTATTGGGACCTAGTCTTGAGAGTTTGGTGCTGTGTTCCGAATTGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.29

Weight (kDa)

5.74

Isoelectric Point (pI)

51.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021331)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 140
AcsI RAATTY 2 cut(s) 19, 117
AjuI GAANNNNNNNTTGG 2 cut(s) 11, 43
Alw26I GTCTC 1 cut(s) 144
ApoI RAATTY 2 cut(s) 19, 117
AspS9I GGNCC 1 cut(s) 182
AvaII GGWCC 1 cut(s) 182
BanI GGYRCC 1 cut(s) 140
BccI CCATC 3 cut(s) 40, 126, 163
BcoDI GTCTC 1 cut(s) 144
BfaI CTAG 1 cut(s) 186
Bme18I GGWCC 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 182
BmiI GGNNCC 2 cut(s) 142, 183
BpuEI CTTGAG 1 cut(s) 212
Bse1I ACTGG 1 cut(s) 118
BseGI GGATG 2 cut(s) 21, 80
BseNI ACTGG 1 cut(s) 118
BshNI GGYRCC 1 cut(s) 140
BslFI GGGAC 1 cut(s) 195
BsmAI GTCTC 1 cut(s) 144
BsmFI GGGAC 1 cut(s) 195
BspLI GGNNCC 2 cut(s) 142, 183
BspT107I GGYRCC 1 cut(s) 140
BsrI ACTGG 1 cut(s) 118
Bst6I CTCTTC 1 cut(s) 5
BstF5I GGATG 2 cut(s) 21, 80
BstMAI GTCTC 1 cut(s) 144
BtgZI GCGATG 1 cut(s) 145
BtsCI GGATG 2 cut(s) 21, 80
Cfr13I GGNCC 1 cut(s) 182
Eam1104I CTCTTC 1 cut(s) 5
EarI CTCTTC 1 cut(s) 5
Eco47I GGWCC 1 cut(s) 182
EcoO109I RGGNCCY 1 cut(s) 182
EcoRI GAATTC 1 cut(s) 117
FaiI YATR 4 cut(s) 8, 88, 90, 98
FaqI GGGAC 1 cut(s) 195
FauNDI CATATG 1 cut(s) 88
FokI GGATG 2 cut(s) 28, 67
FspBI CTAG 1 cut(s) 186
HinfI GANTC 1 cut(s) 57
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 214
Hpy188III TCNNGA 1 cut(s) 191
Hpy8I GTNNAC 1 cut(s) 61
HpyAV CCTTC 1 cut(s) 140
LpnPI CCDG 1 cut(s) 99
MaeI CTAG 1 cut(s) 186
MboII GAAGA 3 cut(s) 22, 52, 55
MluCI AATT 3 cut(s) 19, 117, 215
MlyI GAGTC 1 cut(s) 66
MnlI CCTC 1 cut(s) 6
NdeI CATATG 1 cut(s) 88
NlaIV GGNNCC 2 cut(s) 142, 183
PflFI GACNNNGTC 1 cut(s) 186
PleI GAGTC 1 cut(s) 65
PpsI GAGTC 1 cut(s) 65
PpuMI RGGWCCY 1 cut(s) 182
Psp5II RGGWCCY 1 cut(s) 182
PspN4I GGNNCC 2 cut(s) 142, 183
PspPI GGNCC 1 cut(s) 182
PspPPI RGGWCCY 1 cut(s) 182
PsyI GACNNNGTC 1 cut(s) 186
Sau96I GGNCC 1 cut(s) 182
SchI GAGTC 1 cut(s) 66
SetI ASST 1 cut(s) 187
SgeI CNNG 4 cut(s) 126, 176, 198, 203
SinI GGWCC 1 cut(s) 182
SmlI CTYRAG 1 cut(s) 191
SmoI CTYRAG 1 cut(s) 191
Sse9I AATT 3 cut(s) 19, 117, 215
SspI AATATT 1 cut(s) 76
SspMI CTAG 1 cut(s) 186
TasI AATT 3 cut(s) 19, 117, 215
TspDTI ATGAA 2 cut(s) 23, 32
Tth111I GACNNNGTC 1 cut(s) 186
VpaK11BI GGWCC 1 cut(s) 182
XapI RAATTY 2 cut(s) 19, 117
XcmI CCANNNNNNNNNTGG 1 cut(s) 129
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.