RchiOBHm_Chr3g0493251

TIFY 6B-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
40434275 .. 40437523
3249 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45606

Sequence Viewer

Length: 129 bp
ATGGAGAGGGATTTCTTGGGTTTGAGTTCAAATAAGAGCTGTGTGAATGTGAAAGATGAAGCCAATGATGAACTCAAGAATTCAGTGGGCGGTAAAGGATCCGAAAGAGTATACCCAACAACAACTTGA

Protein Analysis

42

Amino Acids

4.58

Weight (kDa)

5.1

Isoelectric Point (pI)

24.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022706)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0493251
rosa_samantha Rh5BG398200 Rh5CG422200 Rh6BG188900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 111
AciI CCGC 1 cut(s) 90
AclWI GGATC 2 cut(s) 93, 106
AcsI RAATTY 1 cut(s) 79
AgsI TTSAA 1 cut(s) 30
AluBI AGCT 1 cut(s) 39
AluI AGCT 1 cut(s) 39
AlwI GGATC 2 cut(s) 93, 106
ApoI RAATTY 1 cut(s) 79
BamHI GGATCC 1 cut(s) 98
BmiI GGNNCC 1 cut(s) 100
BpuEI CTTGAG 1 cut(s) 59
Bsp143I GATC 1 cut(s) 98
BspACI CCGC 1 cut(s) 90
BspLI GGNNCC 1 cut(s) 100
BspPI GGATC 2 cut(s) 93, 106
BssMI GATC 1 cut(s) 98
BssNAI GTATAC 1 cut(s) 112
Bst1107I GTATAC 1 cut(s) 112
BstKTI GATC 1 cut(s) 101
BstMBI GATC 1 cut(s) 98
BstX2I RGATCY 1 cut(s) 98
BstYI RGATCY 1 cut(s) 98
BstZ17I GTATAC 1 cut(s) 112
BtsIMutI CAGTG 1 cut(s) 90
CviJI RGCY 2 cut(s) 39, 62
CviKI_1 RGCY 2 cut(s) 39, 62
DpnI GATC 1 cut(s) 100
DpnII GATC 1 cut(s) 98
EcoRI GAATTC 1 cut(s) 79
FaiI YATR 1 cut(s) 112
FblI GTMKAC 1 cut(s) 111
FspEI CC 8 cut(s) 2, 3, 71, 72, 75, 76, 81, 115
Hpy166II GTNNAC 1 cut(s) 112
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 1 cut(s) 76
Hpy8I GTNNAC 1 cut(s) 112
Kzo9I GATC 1 cut(s) 98
MalI GATC 1 cut(s) 100
MboI GATC 1 cut(s) 98
MflI RGATCY 1 cut(s) 98
MluCI AATT 1 cut(s) 79
NdeII GATC 1 cut(s) 98
NlaIV GGNNCC 1 cut(s) 100
PspN4I GGNNCC 1 cut(s) 100
PsuI RGATCY 1 cut(s) 98
Sau3AI GATC 1 cut(s) 98
SetI ASST 1 cut(s) 41
SgeI CNNG 2 cut(s) 28, 88
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 1 cut(s) 79
SsiI CCGC 1 cut(s) 90
TasI AATT 1 cut(s) 79
TscAI CASTG 1 cut(s) 90
TspDTI ATGAA 2 cut(s) 72, 84
TspRI CASTG 1 cut(s) 90
XapI RAATTY 1 cut(s) 79
XmiI GTMKAC 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.