Rh6BG188900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
35055736 .. 35069843
14108 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG188900.1

Sequence Viewer

Length: 201 bp
ATGGAGAGGGATTTCTTGGGTTTGAGTTCAAAAAAGAGTTGTGTGAATGTGAAAGATGAAGCCAATGATAAACTCAAGAATTCAGAGTCTATCATAACCAGGCTAAACATAATTGTTTATGCAATAGGTAGTTCCCCAATTGACGTCAACACCTTGGAAAAAAACCCCTCTCTATTCTGCCTTGTCCTGACCCCAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.25

Weight (kDa)

6.12

Isoelectric Point (pI)

41.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022706)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0493251
rosa_samantha Rh5BG398200 Rh5CG422200 Rh6BG188900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 147
AcsI RAATTY 1 cut(s) 79
AcyI GRCGYC 1 cut(s) 144
AgsI TTSAA 1 cut(s) 30
AjnI CCWGG 1 cut(s) 98
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
ApoI RAATTY 1 cut(s) 79
BciT130I CCWGG 1 cut(s) 100
Bme1390I CCNGG 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 100
BpuEI CTTGAG 1 cut(s) 59
BsaHI GRCGYC 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 153
BseBI CCWGG 1 cut(s) 100
BseDI CCNNGG 1 cut(s) 153
BseYI CCCAGC 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 153
BssNI GRCGYC 1 cut(s) 144
BssT1I CCWWGG 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 100
BstACI GRCGYC 1 cut(s) 144
BstNI CCWGG 1 cut(s) 100
BstSCI CCNGG 1 cut(s) 98
CviJI RGCY 3 cut(s) 62, 103, 197
CviKI_1 RGCY 3 cut(s) 62, 103, 197
Eco130I CCWWGG 1 cut(s) 153
EcoRI GAATTC 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 98
EcoT14I CCWWGG 1 cut(s) 153
ErhI CCWWGG 1 cut(s) 153
FaiI YATR 3 cut(s) 95, 110, 120
GsaI CCCAGC 1 cut(s) 197
Hin1I GRCGYC 1 cut(s) 144
HincII GTYRAC 1 cut(s) 148
HindII GTYRAC 1 cut(s) 148
HinfI GANTC 1 cut(s) 86
Hpy166II GTNNAC 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 85
Hpy188III TCNNGA 2 cut(s) 76, 187
Hpy8I GTNNAC 1 cut(s) 148
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 1 cut(s) 122
HpySE526I ACGT 1 cut(s) 144
Hsp92I GRCGYC 1 cut(s) 144
LpnPI CCDG 2 cut(s) 85, 112
MaeII ACGT 1 cut(s) 144
MfeI CAATTG 1 cut(s) 138
MluCI AATT 3 cut(s) 79, 111, 138
MlyI GAGTC 1 cut(s) 95
MnlI CCTC 1 cut(s) 178
MseI TTAA 1 cut(s) 199
MspR9I CCNGG 1 cut(s) 100
MunI CAATTG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 100
PleI GAGTC 1 cut(s) 94
PpsI GAGTC 1 cut(s) 94
Psp6I CCWGG 1 cut(s) 98
PspFI CCCAGC 1 cut(s) 193
PspGI CCWGG 1 cut(s) 98
SaqAI TTAA 1 cut(s) 199
SchI GAGTC 1 cut(s) 95
ScrFI CCNGG 1 cut(s) 100
SetI ASST 4 cut(s) 130, 147, 155, 199
SgeI CNNG 6 cut(s) 28, 88, 111, 112, 166, 194
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 3 cut(s) 79, 111, 138
StyD4I CCNGG 1 cut(s) 98
StyI CCWWGG 1 cut(s) 153
TaiI ACGT 1 cut(s) 147
TasI AATT 3 cut(s) 79, 111, 138
Tru1I TTAA 1 cut(s) 199
Tru9I TTAA 1 cut(s) 199
TspDTI ATGAA 1 cut(s) 72
XapI RAATTY 1 cut(s) 79
ZraI GACGTC 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.