RchiOBHm_Chr4g0405341

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
25716709 .. 25716903
195 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37683

Sequence Viewer

Length: 195 bp
ATGTATGTTTTGGTGAGCTACTTGATGGGAATTCTAGAAGTTTACTTACCTAGCATTGAGTATGTGGTTTTGTCAAGTGAATTTAACACTTTTCAGAACCTGAAGAATTTTTTACTTGATGCCCTTGCTTTTGATAATGTTAATAGTTTGGCCATTTCTTCCACTTCTAATGAAGGTGCTGTAGTGTTGGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.05

Weight (kDa)

4.05

Isoelectric Point (pI)

33.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019331)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 150
AcsI RAATTY 3 cut(s) 30, 80, 106
AcuI CTGAAG 1 cut(s) 122
AluBI AGCT 1 cut(s) 18
AluI AGCT 1 cut(s) 18
AlwNI CAGNNNCTG 1 cut(s) 100
AoxI GGCC 1 cut(s) 150
ApoI RAATTY 3 cut(s) 30, 80, 106
AsuHPI GGTGA 1 cut(s) 25
BalI TGGCCA 1 cut(s) 152
BarI GAAGNNNNNNTAC 2 cut(s) 30, 62
BccI CCATC 1 cut(s) 19
BfaI CTAG 2 cut(s) 35, 51
BfmI CTRYAG 1 cut(s) 180
BmsI GCATC 1 cut(s) 109
BshFI GGCC 1 cut(s) 152
BsnI GGCC 1 cut(s) 152
BspANI GGCC 1 cut(s) 152
BstSFI CTRYAG 1 cut(s) 180
BsuRI GGCC 1 cut(s) 152
CaiI CAGNNNCTG 1 cut(s) 100
CviAII CATG 1 cut(s) 192
CviJI RGCY 2 cut(s) 18, 152
CviKI_1 RGCY 2 cut(s) 18, 152
EaeI YGGCCR 1 cut(s) 150
Eco57I CTGAAG 1 cut(s) 122
EcoRI GAATTC 1 cut(s) 30
FaeI CATG 1 cut(s) 195
FaiI YATR 3 cut(s) 6, 63, 193
FatI CATG 1 cut(s) 191
FspBI CTAG 2 cut(s) 35, 51
HaeIII GGCC 1 cut(s) 152
Hin1II CATG 1 cut(s) 195
HphI GGTGA 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 43
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 1 cut(s) 35
Hpy8I GTNNAC 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 167
Hsp92II CATG 1 cut(s) 195
LpnPI CCDG 1 cut(s) 113
LweI GCATC 1 cut(s) 109
MaeI CTAG 2 cut(s) 35, 51
MboII GAAGA 2 cut(s) 115, 150
MlsI TGGCCA 1 cut(s) 152
MluCI AATT 3 cut(s) 30, 80, 106
MluNI TGGCCA 1 cut(s) 152
Mox20I TGGCCA 1 cut(s) 152
MscI TGGCCA 1 cut(s) 152
MseI TTAA 2 cut(s) 84, 141
Msp20I TGGCCA 1 cut(s) 152
NlaIII CATG 1 cut(s) 195
PstNI CAGNNNCTG 1 cut(s) 100
SaqAI TTAA 2 cut(s) 84, 141
SetI ASST 4 cut(s) 20, 52, 102, 178
SfaNI GCATC 1 cut(s) 109
SfcI CTRYAG 1 cut(s) 180
SgeI CNNG 7 cut(s) 34, 47, 63, 87, 112, 128, 137
Sse9I AATT 3 cut(s) 30, 80, 106
SspMI CTAG 2 cut(s) 35, 51
TasI AATT 3 cut(s) 30, 80, 106
Tru1I TTAA 2 cut(s) 84, 141
Tru9I TTAA 2 cut(s) 84, 141
TspDTI ATGAA 1 cut(s) 186
XapI RAATTY 3 cut(s) 30, 80, 106
XbaI TCTAGA 1 cut(s) 34
XspI CTAG 2 cut(s) 35, 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.