RchiOBHm_Chr4g0413541

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
37801909 .. 37802230
322 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38404

Sequence Viewer

Length: 141 bp
ATGTCACTTTTTCATATCTCTTCTCACTCTCCACTCCGCCGGCTCCCTCTCTCCTTTCTCTCTCCTCGATCTCCACCTCCATTTTCTCTCTCTCTCTCTCTCTCTCTCCACGCCGCCGGTGCAAGATTCCGACGACGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

46

Amino Acids

5.19

Weight (kDa)

12.0

Isoelectric Point (pI)

126.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022735)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0395211 RchiOBHm_Chr4g0413541
rosa_multiflora Rmu_sc0001861.1_g000013
rosa_samantha Rh5BG127500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 37, 114
BisI GCNGC 1 cut(s) 114
BlsI GCNGC 1 cut(s) 115
BmiI GGNNCC 1 cut(s) 44
Bse118I RCCGGY 2 cut(s) 39, 116
BseRI GAGGAG 1 cut(s) 54
BsiSI CCGG 2 cut(s) 40, 117
Bsp143I GATC 1 cut(s) 68
BspACI CCGC 2 cut(s) 37, 114
BspLI GGNNCC 1 cut(s) 44
BsrFI RCCGGY 2 cut(s) 39, 116
BssAI RCCGGY 2 cut(s) 39, 116
BssMI GATC 1 cut(s) 68
Bst6I CTCTTC 1 cut(s) 25
BstC8I GCNNGC 1 cut(s) 41
BstKTI GATC 1 cut(s) 71
BstMBI GATC 1 cut(s) 68
BstMWI GCNNNNNNNGC 1 cut(s) 119
Cac8I GCNNGC 1 cut(s) 41
Cfr10I RCCGGY 2 cut(s) 39, 116
CviJI RGCY 1 cut(s) 43
CviKI_1 RGCY 1 cut(s) 43
DpnI GATC 1 cut(s) 70
DpnII GATC 1 cut(s) 68
Eam1104I CTCTTC 1 cut(s) 25
EarI CTCTTC 1 cut(s) 25
EciI GGCGGA 1 cut(s) 26
FaiI YATR 1 cut(s) 15
Fnu4HI GCNGC 1 cut(s) 114
Fsp4HI GCNGC 1 cut(s) 114
GluI GCNGC 1 cut(s) 114
HapII CCGG 2 cut(s) 40, 117
HinfI GANTC 1 cut(s) 126
HpaII CCGG 2 cut(s) 40, 117
Hpy188I TCNGA 1 cut(s) 131
Hpy99I CGWCG 2 cut(s) 135, 138
HpyCH4V TGCA 1 cut(s) 122
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
KroI GCCGGC 1 cut(s) 39
KroNI GCCGGC 1 cut(s) 41
Kzo9I GATC 1 cut(s) 68
LmnI GCTCC 1 cut(s) 48
LpnPI CCDG 2 cut(s) 53, 130
MaeIII GTNAC 1 cut(s) 3
MalI GATC 1 cut(s) 70
MboI GATC 1 cut(s) 68
MboII GAAGA 1 cut(s) 12
MnlI CCTC 3 cut(s) 57, 75, 87
MroNI GCCGGC 1 cut(s) 39
MspI CCGG 2 cut(s) 40, 117
MspJI CNNR 9 cut(s) 22, 26, 36, 52, 78, 115, 122, 129, 135
MwoI GCNNNNNNNGC 1 cut(s) 119
NaeI GCCGGC 1 cut(s) 41
NdeII GATC 1 cut(s) 68
NgoMIV GCCGGC 1 cut(s) 39
NlaIV GGNNCC 1 cut(s) 44
NmuCI GTSAC 1 cut(s) 3
PdiI GCCGGC 1 cut(s) 41
PfeI GAWTC 1 cut(s) 126
PkrI GCNGC 1 cut(s) 115
PspN4I GGNNCC 1 cut(s) 44
SatI GCNGC 1 cut(s) 114
Sau3AI GATC 1 cut(s) 68
SetI ASST 1 cut(s) 79
SgeI CNNG 5 cut(s) 52, 78, 122, 129, 135
SgrAI CRCCGGYG 1 cut(s) 116
SsiI CCGC 2 cut(s) 37, 114
TaqI TCGA 1 cut(s) 67
TauI GCSGC 1 cut(s) 116
TfiI GAWTC 1 cut(s) 126
TseFI GTSAC 1 cut(s) 3
Tsp45I GTSAC 1 cut(s) 3
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.