RchiOBHm_Chr5g0002771

Malonyl-CoA decarboxylase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
1641621 .. 1641937
317 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28411

Sequence Viewer

Length: 222 bp
ATGCACTCTGCAATTTCAATGAGTAAAACTGAAGTCTTGGATTCTGTGCTGAGTGATTTCTCTGAGGGATATTTCAGCCTTTCGTATGAGAATCGTCGAAAATTGCTTGTGCAACTTGCCAAAGAGTATGATGTTAATAGGACACAAGTTCCCGATTTGATAAAGCAGTATTTGGGACTTGAGCCTCCTGGAACTGGAAGTGAGTTTCGTGTTGTTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.3

Weight (kDa)

5.21

Isoelectric Point (pI)

44.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021428)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0002771
rosa_laevigata RLG00000031058
rosa_rugosa Rorug04G0399300 Rorug04G0399400
rosa_samantha Rh5CG024800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 51
AfiI CCNNNNNNNGG 1 cut(s) 194
AgsI TTSAA 1 cut(s) 18
AjnI CCWGG 1 cut(s) 187
BciT130I CCWGG 1 cut(s) 189
Bme1390I CCNGG 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 189
BpuEI CTTGAG 1 cut(s) 200
Bsc4I CCNNNNNNNGG 1 cut(s) 194
Bse1I ACTGG 1 cut(s) 199
BseBI CCWGG 1 cut(s) 189
BseLI CCNNNNNNNGG 1 cut(s) 194
BseMII CTCAG 2 cut(s) 41, 54
BseNI ACTGG 1 cut(s) 199
BslFI GGGAC 1 cut(s) 189
BslI CCNNNNNNNGG 1 cut(s) 194
BsmFI GGGAC 1 cut(s) 189
BspCNI CTCAG 2 cut(s) 42, 55
BsrI ACTGG 1 cut(s) 199
Bst2UI CCWGG 1 cut(s) 189
BstDEI CTNAG 2 cut(s) 50, 63
BstNI CCWGG 1 cut(s) 189
BstSCI CCNGG 1 cut(s) 187
CviJI RGCY 2 cut(s) 78, 184
CviKI_1 RGCY 2 cut(s) 78, 184
DdeI CTNAG 2 cut(s) 50, 63
Eco57I CTGAAG 1 cut(s) 51
EcoRII CCWGG 1 cut(s) 187
FaiI YATR 2 cut(s) 87, 129
FaqI GGGAC 1 cut(s) 189
HinfI GANTC 2 cut(s) 41, 91
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 152
Hpy99I CGWCG 1 cut(s) 99
HpyCH4V TGCA 3 cut(s) 4, 11, 112
HpyF3I CTNAG 2 cut(s) 50, 63
LpnPI CCDG 3 cut(s) 174, 180, 201
MluCI AATT 3 cut(s) 12, 101, 217
MnlI CCTC 2 cut(s) 58, 195
MseI TTAA 2 cut(s) 135, 216
MspR9I CCNGG 1 cut(s) 189
MvaI CCWGG 1 cut(s) 189
PfeI GAWTC 2 cut(s) 41, 91
PfoI TCCNGGA 1 cut(s) 187
Psp6I CCWGG 1 cut(s) 187
PspGI CCWGG 1 cut(s) 187
SaqAI TTAA 2 cut(s) 135, 216
ScrFI CCNGG 1 cut(s) 189
SgeI CNNG 9 cut(s) 49, 119, 128, 158, 164, 191, 200, 201, 207
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 3 cut(s) 12, 101, 217
StyD4I CCNGG 1 cut(s) 187
TaqI TCGA 1 cut(s) 97
TasI AATT 3 cut(s) 12, 101, 217
TfiI GAWTC 2 cut(s) 41, 91
Tru1I TTAA 2 cut(s) 135, 216
Tru9I TTAA 2 cut(s) 135, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.