Rh5CG024800

Malonyl-CoA decarboxylase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
1564764 .. 1565971
1208 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG024800.1

Sequence Viewer

Length: 219 bp
ATGCGAACCAGAATGAGACCCACCAACAACGATTCAGCTCACCTCGATCGCTCTCCTCTCGCCGGATATTTCAGCCTTTCGTATGAGAATCGTCGAAAATTGCTTGTGCAACTTGCCAAAGAGTATGATGTTAATAGGACACAAGTTCCCGATTTGATAAAGCAGTATTTGGGACTTGAGCCTCCTGGAACTGGAAGTGAGTTTCGTGTTGTTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.32

Weight (kDa)

9.59

Isoelectric Point (pI)

35.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021428)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0002771
rosa_laevigata RLG00000031058
rosa_rugosa Rorug04G0399300 Rorug04G0399400
rosa_samantha Rh5CG024800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 62, 191
AjnI CCWGG 1 cut(s) 184
AluBI AGCT 1 cut(s) 38
AluI AGCT 1 cut(s) 38
Alw26I GTCTC 1 cut(s) 10
AsuHPI GGTGA 1 cut(s) 32
BciT130I CCWGG 1 cut(s) 186
BcoDI GTCTC 1 cut(s) 10
Bme1390I CCNGG 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 186
BpuEI CTTGAG 1 cut(s) 197
BsaI GGTCTC 1 cut(s) 10
Bsc4I CCNNNNNNNGG 2 cut(s) 62, 191
Bse1I ACTGG 1 cut(s) 196
BseBI CCWGG 1 cut(s) 186
BseLI CCNNNNNNNGG 2 cut(s) 62, 191
BseNI ACTGG 1 cut(s) 196
BseRI GAGGAG 1 cut(s) 45
Bsh1285I CGRYCG 1 cut(s) 49
BsiEI CGRYCG 1 cut(s) 49
BsiSI CCGG 1 cut(s) 63
BslFI GGGAC 1 cut(s) 186
BslI CCNNNNNNNGG 2 cut(s) 62, 191
BsmAI GTCTC 1 cut(s) 10
BsmFI GGGAC 1 cut(s) 186
Bso31I GGTCTC 1 cut(s) 10
Bsp143I GATC 1 cut(s) 46
BspTNI GGTCTC 1 cut(s) 10
BsrI ACTGG 1 cut(s) 196
BssMI GATC 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 186
BstKTI GATC 1 cut(s) 49
BstMAI GTCTC 1 cut(s) 10
BstMBI GATC 1 cut(s) 46
BstMCI CGRYCG 1 cut(s) 49
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
CviJI RGCY 3 cut(s) 38, 75, 181
CviKI_1 RGCY 3 cut(s) 38, 75, 181
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eco31I GGTCTC 1 cut(s) 10
EcoRII CCWGG 1 cut(s) 184
FaiI YATR 2 cut(s) 84, 126
FaqI GGGAC 1 cut(s) 186
HapII CCGG 1 cut(s) 63
HinfI GANTC 2 cut(s) 32, 88
HpaII CCGG 1 cut(s) 63
HphI GGTGA 1 cut(s) 32
Hpy188III TCNNGA 1 cut(s) 149
Hpy99I CGWCG 1 cut(s) 96
HpyCH4V TGCA 1 cut(s) 109
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 5 cut(s) 22, 76, 171, 177, 198
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MluCI AATT 2 cut(s) 98, 214
MnlI CCTC 3 cut(s) 53, 66, 192
MseI TTAA 2 cut(s) 132, 213
MspI CCGG 1 cut(s) 63
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NdeII GATC 1 cut(s) 46
PfeI GAWTC 2 cut(s) 32, 88
PfoI TCCNGGA 1 cut(s) 184
Ple19I CGATCG 1 cut(s) 49
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PvuI CGATCG 1 cut(s) 49
SaqAI TTAA 2 cut(s) 132, 213
Sau3AI GATC 1 cut(s) 46
ScrFI CCNGG 1 cut(s) 186
SetI ASST 2 cut(s) 40, 45
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
Sse9I AATT 2 cut(s) 98, 214
StyD4I CCNGG 1 cut(s) 184
TaqI TCGA 2 cut(s) 45, 94
TasI AATT 2 cut(s) 98, 214
TfiI GAWTC 2 cut(s) 32, 88
Tru1I TTAA 2 cut(s) 132, 213
Tru9I TTAA 2 cut(s) 132, 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.