RchiOBHm_Chr5g0012751
ERF Family

Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0021431
Physical Location & Seq
Reverse (-)
8667040 .. 8667494
455 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29330

Sequence Viewer

Length: 249 bp
ATGAATGTGATCACTTTCTATGCTCCTGTCTTGTTCAAAACTATAAGATTCGGAAGCAGTGCTTCTCTCGCTTCTGCACTGATCACTAATGGGGTTAATTTTTTTGCAACTTTTGTTTCAATTGGTCTTGCTGACGAGTTTGGAAGAAGGTTCATTTTCTTGGAGGATGGTTTGCAGATGTTCATATATAACTCAGGTCGTAGTTGGAAGTGCAATGGCTTGGAAATTTGGTACTGGTGGCAACCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sugar_tr

Protein Analysis

82

Amino Acids

9.43

Weight (kDa)

7.9

Isoelectric Point (pI)

38.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sugar_tr PF00083 1 - 62 6.3e-11 Sugar (and other) transporter
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021431)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0012741 RchiOBHm_Chr5g0012751
rosa_multiflora Rmu_sc0000089.1_g000008
rosa_roxburghii Rroxscaffold_1G00063860
rosa_rugosa Rorug05G0004000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 225
AfaI GTAC 1 cut(s) 233
AgsI TTSAA 2 cut(s) 37, 120
ApoI RAATTY 1 cut(s) 225
BccI CCATC 1 cut(s) 161
BclI TGATCA 2 cut(s) 9, 81
BfaI CTAG 1 cut(s) 247
Bse1I ACTGG 1 cut(s) 239
Bse3DI GCAATG 1 cut(s) 220
BseGI GGATG 1 cut(s) 172
BseMI GCAATG 1 cut(s) 220
BseMII CTCAG 1 cut(s) 207
BseNI ACTGG 1 cut(s) 239
BsgI GTGCAG 1 cut(s) 60
Bsp143I GATC 2 cut(s) 9, 81
BspCNI CTCAG 1 cut(s) 206
BsrDI GCAATG 1 cut(s) 220
BsrI ACTGG 1 cut(s) 239
BssMI GATC 2 cut(s) 9, 81
BstDEI CTNAG 1 cut(s) 193
BstF5I GGATG 1 cut(s) 172
BstKTI GATC 2 cut(s) 12, 84
BstMBI GATC 2 cut(s) 9, 81
BstMWI GCNNNNNNNGC 1 cut(s) 68
BtsCI GGATG 1 cut(s) 172
BtsI GCAGTG 1 cut(s) 64
BtsIMutI CAGTG 2 cut(s) 64, 77
Csp6I GTAC 1 cut(s) 232
CviJI RGCY 1 cut(s) 219
CviKI_1 RGCY 1 cut(s) 219
CviQI GTAC 1 cut(s) 232
DdeI CTNAG 1 cut(s) 193
DpnI GATC 2 cut(s) 11, 83
DpnII GATC 2 cut(s) 9, 81
FaiI YATR 5 cut(s) 21, 44, 185, 187, 189
FalI AAGNNNNNCTT 2 cut(s) 46, 78
FbaI TGATCA 2 cut(s) 9, 81
FokI GGATG 1 cut(s) 179
FspBI CTAG 1 cut(s) 247
HinfI GANTC 1 cut(s) 48
Hpy188I TCNGA 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 141
HpyCH4V TGCA 4 cut(s) 77, 107, 175, 213
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 193
Ksp22I TGATCA 2 cut(s) 9, 81
Kzo9I GATC 2 cut(s) 9, 81
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 3 cut(s) 39, 180, 220
MaeI CTAG 1 cut(s) 247
MalI GATC 2 cut(s) 11, 83
MboI GATC 2 cut(s) 9, 81
MboII GAAGA 1 cut(s) 156
MfeI CAATTG 1 cut(s) 120
MluCI AATT 3 cut(s) 97, 120, 225
MmeI TCCRAC 1 cut(s) 185
MnlI CCTC 1 cut(s) 157
MseI TTAA 1 cut(s) 96
MunI CAATTG 1 cut(s) 120
MwoI GCNNNNNNNGC 1 cut(s) 68
NdeII GATC 2 cut(s) 9, 81
PfeI GAWTC 1 cut(s) 48
RsaI GTAC 1 cut(s) 233
RsaNI GTAC 1 cut(s) 232
SaqAI TTAA 1 cut(s) 96
Sau3AI GATC 2 cut(s) 9, 81
SetI ASST 2 cut(s) 152, 199
SgeI CNNG 8 cut(s) 38, 43, 80, 140, 148, 172, 207, 232
Sse9I AATT 3 cut(s) 97, 120, 225
SspMI CTAG 1 cut(s) 247
TasI AATT 3 cut(s) 97, 120, 225
TfiI GAWTC 1 cut(s) 48
Tru1I TTAA 1 cut(s) 96
Tru9I TTAA 1 cut(s) 96
TscAI CASTG 2 cut(s) 64, 84
TspDTI ATGAA 3 cut(s) 17, 142, 172
TspRI CASTG 2 cut(s) 64, 84
XapI RAATTY 1 cut(s) 225
XspI CTAG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.