RchiOBHm_Chr5g0026011

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
19997635 .. 19998015
381 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30561

Sequence Viewer

Length: 249 bp
ATGGTGAATTATGAAATTCTATATTGCTATAGCATCTGGGAAGGTTGGGAAGTAATAAAATTTGGCAGATATGTTGGGATATTTCTAATTTTTTACTTGCAAGTTAATTTATTCAAGTATAATCTCCCAGCAATGTTGTTTCACAACATAGACATGGTCAATTATCATGTGCAGTTTAGTGATATATCAAGAGATAATGCATTAAAAAAAAGTTCTTTTGTTCATAGTGTACCTTGCTTATGGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.89

Weight (kDa)

6.81

Isoelectric Point (pI)

40.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019349)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 15, 59
AfaI GTAC 1 cut(s) 231
AgsI TTSAA 1 cut(s) 115
ApoI RAATTY 2 cut(s) 15, 59
AsuHPI GGTGA 1 cut(s) 16
BfmI CTRYAG 1 cut(s) 28
BmsI GCATC 1 cut(s) 42
Bse3DI GCAATG 1 cut(s) 138
BseMI GCAATG 1 cut(s) 138
BseYI CCCAGC 1 cut(s) 127
BsgI GTGCAG 1 cut(s) 191
BsrDI GCAATG 1 cut(s) 138
BstSFI CTRYAG 1 cut(s) 28
Csp6I GTAC 1 cut(s) 230
CviAII CATG 2 cut(s) 154, 167
CviQI GTAC 1 cut(s) 230
EcoT22I ATGCAT 1 cut(s) 202
FaeI CATG 2 cut(s) 157, 170
FatI CATG 2 cut(s) 153, 166
GsaI CCCAGC 1 cut(s) 131
Hin1II CATG 2 cut(s) 157, 170
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 230
Hpy188III TCNNGA 1 cut(s) 189
Hpy8I GTNNAC 1 cut(s) 230
HpyAV CCTTC 1 cut(s) 35
HpyCH4V TGCA 3 cut(s) 100, 172, 200
Hsp92II CATG 2 cut(s) 157, 170
LpnPI CCDG 2 cut(s) 22, 141
LweI GCATC 1 cut(s) 42
MluCI AATT 6 cut(s) 7, 15, 59, 87, 106, 160
Mph1103I ATGCAT 1 cut(s) 202
MseI TTAA 2 cut(s) 105, 203
MslI CAYNNNNRTG 1 cut(s) 152
NlaIII CATG 2 cut(s) 157, 170
NsiI ATGCAT 1 cut(s) 202
PflFI GACNNNGTC 1 cut(s) 155
PspFI CCCAGC 1 cut(s) 127
PsyI GACNNNGTC 1 cut(s) 155
RsaI GTAC 1 cut(s) 231
RsaNI GTAC 1 cut(s) 230
RseI CAYNNNNRTG 1 cut(s) 152
SaqAI TTAA 2 cut(s) 105, 203
SetI ASST 2 cut(s) 46, 235
SfaNI GCATC 1 cut(s) 42
SfcI CTRYAG 1 cut(s) 28
SgeI CNNG 8 cut(s) 49, 109, 113, 127, 140, 166, 179, 201
SmiMI CAYNNNNRTG 1 cut(s) 152
Sse9I AATT 6 cut(s) 7, 15, 59, 87, 106, 160
TasI AATT 6 cut(s) 7, 15, 59, 87, 106, 160
Tru1I TTAA 2 cut(s) 105, 203
Tru9I TTAA 2 cut(s) 105, 203
TspDTI ATGAA 2 cut(s) 27, 212
Tth111I GACNNNGTC 1 cut(s) 155
XapI RAATTY 2 cut(s) 15, 59
Zsp2I ATGCAT 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.