RchiOBHm_Chr7g0223091

GPN-loop GTPase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
44705624 .. 44706149
526 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19974

Sequence Viewer

Length: 189 bp
ATGGCTTTAGATATCAGGGAGCAGGTTAAGTTGGATGATGTTATGGAGGAAGTTGGACTGGGTCCCAATGAGGGATTGGAGGATTACCTGGATGATGACTACTTGGTTTTTGACTGCCCAGGTATGCATAAGAGCATACGTGTTCCGTTGTCTGTGTCTATTATCATGCATCAGCTCTTGAAAGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.0

Weight (kDa)

4.29

Isoelectric Point (pI)

46.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 13
AfiI CCNNNNNNNGG 1 cut(s) 71
AflIII ACRYGT 1 cut(s) 139
AgsI TTSAA 1 cut(s) 181
AjnI CCWGG 2 cut(s) 87, 118
AluBI AGCT 1 cut(s) 175
AluI AGCT 1 cut(s) 175
AspS9I GGNCC 1 cut(s) 62
AvaII GGWCC 1 cut(s) 62
BciT130I CCWGG 2 cut(s) 89, 120
BfuAI ACCTGC 1 cut(s) 13
Bme1390I CCNGG 2 cut(s) 89, 120
Bme18I GGWCC 1 cut(s) 62
BmgT120I GGNCC 1 cut(s) 62
BmiI GGNNCC 2 cut(s) 63, 64
BmrFI CCNGG 2 cut(s) 89, 120
BmrI ACTGGG 1 cut(s) 68
BmsI GCATC 1 cut(s) 178
BmuI ACTGGG 1 cut(s) 68
BsaAI YACGTR 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 118
Bsc4I CCNNNNNNNGG 1 cut(s) 71
Bse1I ACTGG 1 cut(s) 63
BseBI CCWGG 2 cut(s) 89, 120
BseDI CCNNGG 1 cut(s) 118
BseGI GGATG 2 cut(s) 40, 97
BseLI CCNNNNNNNGG 1 cut(s) 71
BseNI ACTGG 1 cut(s) 63
BslFI GGGAC 1 cut(s) 48
BslI CCNNNNNNNGG 1 cut(s) 71
BsmFI GGGAC 1 cut(s) 48
BspLI GGNNCC 2 cut(s) 63, 64
BspMI ACCTGC 1 cut(s) 13
BsrI ACTGG 1 cut(s) 63
BssECI CCNNGG 1 cut(s) 118
Bst2UI CCWGG 2 cut(s) 89, 120
BstBAI YACGTR 1 cut(s) 140
BstF5I GGATG 2 cut(s) 40, 97
BstNI CCWGG 2 cut(s) 89, 120
BstSCI CCNGG 2 cut(s) 87, 118
BtsCI GGATG 2 cut(s) 40, 97
BveI ACCTGC 1 cut(s) 13
Cfr13I GGNCC 1 cut(s) 62
CviAII CATG 1 cut(s) 166
CviJI RGCY 2 cut(s) 5, 175
CviKI_1 RGCY 2 cut(s) 5, 175
Eco32I GATATC 1 cut(s) 13
Eco47I GGWCC 1 cut(s) 62
EcoO109I RGGNCCY 1 cut(s) 62
EcoRII CCWGG 2 cut(s) 87, 118
EcoRV GATATC 1 cut(s) 13
EcoT22I ATGCAT 2 cut(s) 129, 171
FaeI CATG 1 cut(s) 169
FaiI YATR 5 cut(s) 44, 125, 129, 137, 167
FaqI GGGAC 1 cut(s) 48
FatI CATG 1 cut(s) 165
FokI GGATG 2 cut(s) 47, 104
Hin1II CATG 1 cut(s) 169
Hpy188III TCNNGA 1 cut(s) 178
HpyCH4IV ACGT 1 cut(s) 139
HpyCH4V TGCA 2 cut(s) 127, 169
HpySE526I ACGT 1 cut(s) 139
Hsp92II CATG 1 cut(s) 169
KflI GGGWCCC 1 cut(s) 62
LmnI GCTCC 1 cut(s) 19
LpnPI CCDG 6 cut(s) 8, 44, 74, 101, 105, 132
LweI GCATC 1 cut(s) 178
MaeII ACGT 1 cut(s) 139
MmeI TCCRAC 2 cut(s) 12, 34
MnlI CCTC 3 cut(s) 40, 64, 73
Mph1103I ATGCAT 2 cut(s) 129, 171
MseI TTAA 1 cut(s) 27
MspR9I CCNGG 2 cut(s) 89, 120
MvaI CCWGG 2 cut(s) 89, 120
NlaIII CATG 1 cut(s) 169
NlaIV GGNNCC 2 cut(s) 63, 64
NsiI ATGCAT 2 cut(s) 129, 171
PflFI GACNNNGTC 1 cut(s) 60
Ppu21I YACGTR 1 cut(s) 140
PpuMI RGGWCCY 1 cut(s) 62
Psp5II RGGWCCY 1 cut(s) 62
Psp6I CCWGG 2 cut(s) 87, 118
PspGI CCWGG 2 cut(s) 87, 118
PspN4I GGNNCC 2 cut(s) 63, 64
PspPI GGNCC 1 cut(s) 62
PspPPI RGGWCCY 1 cut(s) 62
PsyI GACNNNGTC 1 cut(s) 60
SaqAI TTAA 1 cut(s) 27
Sau96I GGNCC 1 cut(s) 62
ScrFI CCNGG 2 cut(s) 89, 120
SetI ASST 6 cut(s) 27, 90, 124, 142, 177, 187
SfaNI GCATC 1 cut(s) 178
SinI GGWCC 1 cut(s) 62
StyD4I CCNGG 2 cut(s) 87, 118
TaiI ACGT 1 cut(s) 142
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TspGWI ACGGA 1 cut(s) 135
Tth111I GACNNNGTC 1 cut(s) 60
VpaK11BI GGWCC 1 cut(s) 62
XcmI CCANNNNNNNNNTGG 1 cut(s) 73
Zsp2I ATGCAT 2 cut(s) 129, 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.