Rmu_sc0003895.1_g000028

Zinc finger MYM-type protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003895.1
OG0020464
Physical Location & Seq
Reverse (-)
122653 .. 124275
1623 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003895.1_g000028.1.cds

Sequence Viewer

Length: 591 bp
atggaaattgagcctgtatttcctgtgaagcgtagggttaaaagaaagagacattttgatgagattcatgatacagatagagaacaacaatcagctcaagaagattttagaactgattactttcttgtcttagttgatatggctctttctcaattgaagagtagatttgaacaaatggaaagttttgaatatgtatttggcttcttatttgatgcatcacggttggtttcattggatcacgaagaaatgaaaaattgttgcttgaaacttgaacttgctttgaaacatggtgaggtgtctgatattgatgcaaaatatttgctttctgagttacaagagagcaaagagcagcttggaaccaatggtagctttgatcttgctgcagagcattttgactaccctgtggctttagatatcagggagctagttaacttggatgatgttatggaggaacttggactaggtctcaatgagggattagaggattacctggatgatgactacatagtttttgactgcccaagtatgcatacgagcatacgtgttccgtcgtctgtatctattatcatgcatcaactgttgaaaggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

196

Amino Acids

22.75

Weight (kDa)

4.55

Isoelectric Point (pI)

55.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 243
AflIII ACRYGT 1 cut(s) 541
AgsI TTSAA 7 cut(s) 157, 170, 188, 265, 272, 283, 583
AjnI CCWGG 1 cut(s) 489
AjuI GAANNNNNNNTTGG 2 cut(s) 180, 212
AluBI AGCT 4 cut(s) 95, 352, 369, 424
AluI AGCT 4 cut(s) 95, 352, 369, 424
Alw26I GTCTC 2 cut(s) 43, 470
AlwI GGATC 1 cut(s) 243
ApeKI GCWGC 2 cut(s) 349, 380
AsuHPI GGTGA 1 cut(s) 302
BbvI GCAGC 2 cut(s) 361, 367
BciT130I CCWGG 1 cut(s) 491
BcoDI GTCTC 2 cut(s) 43, 470
BfaI CTAG 2 cut(s) 425, 461
BfmI CTRYAG 1 cut(s) 381
BisI GCNGC 2 cut(s) 350, 381
BlsI GCNGC 2 cut(s) 351, 382
Bme1390I CCNGG 1 cut(s) 491
BmiI GGNNCC 1 cut(s) 358
BmrFI CCNGG 1 cut(s) 491
BmsI GCATC 4 cut(s) 202, 224, 298, 580
BpuEI CTTGAG 1 cut(s) 81
BsaAI YACGTR 1 cut(s) 542
BsaI GGTCTC 1 cut(s) 470
BseBI CCWGG 1 cut(s) 491
BseGI GGATG 2 cut(s) 442, 499
BseMII CTCAG 1 cut(s) 318
BseXI GCAGC 2 cut(s) 361, 367
BsmAI GTCTC 2 cut(s) 43, 470
Bso31I GGTCTC 1 cut(s) 470
Bsp143I GATC 2 cut(s) 235, 373
BspCNI CTCAG 1 cut(s) 319
BspHI TCATGA 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 358
BspMAI CTGCAG 1 cut(s) 385
BspPI GGATC 1 cut(s) 243
BspTNI GGTCTC 1 cut(s) 470
BssMI GATC 2 cut(s) 235, 373
Bst2UI CCWGG 1 cut(s) 491
Bst4CI ACNGT 2 cut(s) 222, 579
Bst6I CTCTTC 1 cut(s) 152
BstBAI YACGTR 1 cut(s) 542
BstDEI CTNAG 2 cut(s) 130, 327
BstF5I GGATG 2 cut(s) 442, 499
BstKTI GATC 2 cut(s) 238, 376
BstMAI GTCTC 2 cut(s) 43, 470
BstMBI GATC 2 cut(s) 235, 373
BstNI CCWGG 1 cut(s) 491
BstSCI CCNGG 1 cut(s) 489
BstSFI CTRYAG 1 cut(s) 381
BstV1I GCAGC 2 cut(s) 361, 367
BtsCI GGATG 2 cut(s) 442, 499
CciI TCATGA 1 cut(s) 67
CviAII CATG 3 cut(s) 68, 287, 568
CviJI RGCY 8 cut(s) 13, 95, 143, 201, 352, 369, 407, 424
CviKI_1 RGCY 8 cut(s) 13, 95, 143, 201, 352, 369, 407, 424
DdeI CTNAG 2 cut(s) 130, 327
DpnI GATC 2 cut(s) 237, 375
DpnII GATC 2 cut(s) 235, 373
Eam1104I CTCTTC 1 cut(s) 152
EarI CTCTTC 1 cut(s) 152
Eco31I GGTCTC 1 cut(s) 470
Eco32I GATATC 1 cut(s) 415
EcoRII CCWGG 1 cut(s) 489
EcoRV GATATC 1 cut(s) 415
EcoT22I ATGCAT 3 cut(s) 217, 531, 573
FaeI CATG 3 cut(s) 71, 290, 571
FalI AAGNNNNNCTT 2 cut(s) 336, 368
FatI CATG 3 cut(s) 67, 286, 567
Fnu4HI GCNGC 2 cut(s) 350, 381
FokI GGATG 2 cut(s) 449, 506
Fsp4HI GCNGC 2 cut(s) 350, 381
FspBI CTAG 2 cut(s) 425, 461
GluI GCNGC 2 cut(s) 350, 381
Hin1II CATG 3 cut(s) 71, 290, 571
HincII GTYRAC 1 cut(s) 430
HindII GTYRAC 1 cut(s) 430
HinfI GANTC 1 cut(s) 64
HpaI GTTAAC 1 cut(s) 430
HphI GGTGA 1 cut(s) 302
Hpy166II GTNNAC 1 cut(s) 430
Hpy188I TCNGA 2 cut(s) 301, 328
Hpy188III TCNNGA 3 cut(s) 68, 98, 239
Hpy8I GTNNAC 1 cut(s) 430
Hpy99I CGWCG 1 cut(s) 553
HpyCH4III ACNGT 2 cut(s) 222, 579
HpyCH4IV ACGT 1 cut(s) 541
HpyCH4V TGCA 5 cut(s) 215, 311, 383, 529, 571
HpyF3I CTNAG 2 cut(s) 130, 327
HpySE526I ACGT 1 cut(s) 541
Hsp92II CATG 3 cut(s) 71, 290, 571
KspAI GTTAAC 1 cut(s) 430
Kzo9I GATC 2 cut(s) 235, 373
LmnI GCTCC 1 cut(s) 421
LpnPI CCDG 6 cut(s) 27, 36, 403, 414, 476, 503
Lsp1109I GCAGC 2 cut(s) 361, 367
LweI GCATC 4 cut(s) 202, 224, 298, 580
MaeI CTAG 2 cut(s) 425, 461
MaeII ACGT 1 cut(s) 541
MaeIII GTNAC 1 cut(s) 330
MalI GATC 2 cut(s) 237, 375
MboI GATC 2 cut(s) 235, 373
MboII GAAGA 3 cut(s) 113, 169, 254
MfeI CAATTG 1 cut(s) 152
MluCI AATT 3 cut(s) 6, 152, 253
MnlI CCTC 4 cut(s) 286, 442, 466, 475
Mph1103I ATGCAT 3 cut(s) 217, 531, 573
MseI TTAA 2 cut(s) 39, 429
MslI CAYNNNNRTG 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 491
MunI CAATTG 1 cut(s) 152
MvaI CCWGG 1 cut(s) 491
NdeII GATC 2 cut(s) 235, 373
NlaIII CATG 3 cut(s) 71, 290, 571
NlaIV GGNNCC 1 cut(s) 358
NsiI ATGCAT 3 cut(s) 217, 531, 573
PagI TCATGA 1 cut(s) 67
PfeI GAWTC 1 cut(s) 64
PflFI GACNNNGTC 1 cut(s) 462
PkrI GCNGC 2 cut(s) 351, 382
Ppu21I YACGTR 1 cut(s) 542
Psp6I CCWGG 1 cut(s) 489
PspGI CCWGG 1 cut(s) 489
PspN4I GGNNCC 1 cut(s) 358
PstI CTGCAG 1 cut(s) 385
PsyI GACNNNGTC 1 cut(s) 462
RseI CAYNNNNRTG 1 cut(s) 57
SaqAI TTAA 2 cut(s) 39, 429
SatI GCNGC 2 cut(s) 350, 381
Sau3AI GATC 2 cut(s) 235, 373
ScrFI CCNGG 1 cut(s) 491
SetI ASST 9 cut(s) 97, 297, 354, 371, 426, 466, 492, 544, 589
SfaNI GCATC 4 cut(s) 202, 224, 298, 580
SfcI CTRYAG 1 cut(s) 381
SmiMI CAYNNNNRTG 1 cut(s) 57
SmlI CTYRAG 1 cut(s) 96
SmoI CTYRAG 1 cut(s) 96
Sse9I AATT 3 cut(s) 6, 152, 253
SspI AATATT 1 cut(s) 317
SspMI CTAG 2 cut(s) 425, 461
StyD4I CCNGG 1 cut(s) 489
TaaI ACNGT 2 cut(s) 222, 579
TaiI ACGT 1 cut(s) 544
TasI AATT 3 cut(s) 6, 152, 253
TfiI GAWTC 1 cut(s) 64
Tru1I TTAA 2 cut(s) 39, 429
Tru9I TTAA 2 cut(s) 39, 429
TseI GCWGC 2 cut(s) 349, 380
TspDTI ATGAA 3 cut(s) 56, 219, 263
TspGWI ACGGA 1 cut(s) 537
Tth111I GACNNNGTC 1 cut(s) 462
XspI CTAG 2 cut(s) 425, 461
Zsp2I ATGCAT 3 cut(s) 217, 531, 573
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.