RchiOBHm_Chr7g0234071

mRNA-decapping enzyme-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0022812
Physical Location & Seq
Reverse (-)
58649588 .. 58651792
2205 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20976

Sequence Viewer

Length: 240 bp
ATGTCTAATGTATATTACCCTATAGTTGTTACAGTTTTTTTATTTTATTTTATAATTATGTCTTTATATTATACAGATAACCTAGTGGAGAATCTCTTGGGAGATTTTGAGTATGAAGTTCAAGTTCCATATTTGTCGTATAGGAATGCAGCTCAGGAAGTTAATGGCATTTCGTTTTATAATTCACGTGAATGTGAGGAAGTTGCAAATCTCTTCACTAGGTACAGTATTTATCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03018 map03018
Pfam Domains
Protein Families
DCP1

Protein Analysis

79

Amino Acids

9.43

Weight (kDa)

4.1

Isoelectric Point (pI)

39.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DCP1 PF06058 16 - 73 1.6e-12 Dcp1-like decapping family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022812)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0234071
rosa_laevigata RLG00000001868
rosa_roxburghii Rroxscaffold_1G00044390
rosa_samantha Rh5AG422800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 53, 180
AcvI CACGTG 1 cut(s) 188
AfaI GTAC 1 cut(s) 224
AgsI TTSAA 1 cut(s) 122
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
ApeKI GCWGC 1 cut(s) 149
BbrPI CACGTG 1 cut(s) 188
BbvI GCAGC 1 cut(s) 161
BfaI CTAG 2 cut(s) 83, 219
BfmI CTRYAG 1 cut(s) 21
BisI GCNGC 1 cut(s) 150
BlsI GCNGC 1 cut(s) 151
Bpu10I CCTNAGC 1 cut(s) 153
BsaAI YACGTR 1 cut(s) 188
BseMII CTCAG 1 cut(s) 167
BseXI GCAGC 1 cut(s) 161
BsmI GAATGC 1 cut(s) 151
BspCNI CTCAG 1 cut(s) 166
Bst4CI ACNGT 2 cut(s) 34, 227
Bst6I CTCTTC 1 cut(s) 218
BstBAI YACGTR 1 cut(s) 188
BstDEI CTNAG 1 cut(s) 153
BstSFI CTRYAG 1 cut(s) 21
BstV1I GCAGC 1 cut(s) 161
Csp6I GTAC 1 cut(s) 223
CviJI RGCY 1 cut(s) 152
CviKI_1 RGCY 1 cut(s) 152
CviQI GTAC 1 cut(s) 223
DdeI CTNAG 1 cut(s) 153
Eam1104I CTCTTC 1 cut(s) 218
EarI CTCTTC 1 cut(s) 218
Eco72I CACGTG 1 cut(s) 188
Fnu4HI GCNGC 1 cut(s) 150
Fsp4HI GCNGC 1 cut(s) 150
FspBI CTAG 2 cut(s) 83, 219
GluI GCNGC 1 cut(s) 150
HinfI GANTC 1 cut(s) 91
Hpy188III TCNNGA 1 cut(s) 155
HpyCH4III ACNGT 2 cut(s) 34, 227
HpyCH4IV ACGT 1 cut(s) 187
HpyCH4V TGCA 2 cut(s) 149, 206
HpyF3I CTNAG 1 cut(s) 153
HpySE526I ACGT 1 cut(s) 187
LpnPI CCDG 1 cut(s) 140
Lsp1109I GCAGC 1 cut(s) 161
MaeI CTAG 2 cut(s) 83, 219
MaeII ACGT 1 cut(s) 187
MaeIII GTNAC 1 cut(s) 28
MboII GAAGA 1 cut(s) 205
MluCI AATT 2 cut(s) 54, 181
MnlI CCTC 1 cut(s) 190
MseI TTAA 2 cut(s) 162, 238
MslI CAYNNNNRTG 1 cut(s) 190
Mva1269I GAATGC 1 cut(s) 151
PctI GAATGC 1 cut(s) 151
PfeI GAWTC 1 cut(s) 91
PkrI GCNGC 1 cut(s) 151
PmaCI CACGTG 1 cut(s) 188
PmlI CACGTG 1 cut(s) 188
Ppu21I YACGTR 1 cut(s) 188
PsiI TTATAA 2 cut(s) 53, 180
PspCI CACGTG 1 cut(s) 188
RsaI GTAC 1 cut(s) 224
RsaNI GTAC 1 cut(s) 223
RseI CAYNNNNRTG 1 cut(s) 190
SaqAI TTAA 2 cut(s) 162, 238
SatI GCNGC 1 cut(s) 150
SetI ASST 4 cut(s) 84, 154, 190, 224
SfcI CTRYAG 1 cut(s) 21
SgeI CNNG 7 cut(s) 95, 109, 134, 167, 198, 200, 231
SmiMI CAYNNNNRTG 1 cut(s) 190
Sse9I AATT 2 cut(s) 54, 181
SspMI CTAG 2 cut(s) 83, 219
TaaI ACNGT 2 cut(s) 34, 227
TaiI ACGT 1 cut(s) 190
TasI AATT 2 cut(s) 54, 181
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 2 cut(s) 162, 238
Tru9I TTAA 2 cut(s) 162, 238
TseI GCWGC 1 cut(s) 149
TspDTI ATGAA 1 cut(s) 129
XspI CTAG 2 cut(s) 83, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.